Description :
From Genome Similarity Track
Location :
Scaffold_717:6205- 7206
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_717-fgenesh-gene-0.2Ubiquinone biosynthesis protein COQ9

Sequence
1001 bases(100 bases per row)
ATGTTCTTCCCTCGCCTGCTCTTTCTGTCTCCATGTACTCCGGCGCCGCCCTGTCCCAAAAGCAACCCCCACGGGTGATCGCCATGGGAGAAACTCGCGG
CCGCCCCGTCCGATTCCTCCGCAGTCGCGAATCTTCGGCCGACACCACAAGCCCCTTCTTCCATCTCGCCCTCCGCTTGCTCCAGAATCGGCATGTACTC
GCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCGCGTACGTGGGCCACCGCGTCGTCGA
ACTCCTCACGGAGCAGCAGCTCGTGGACCACGCCGTGAGCGTGCTCCCGCAGCTCCAGTCCGTGGCTGCGCGGCCGCACTTCCACGGTCCCCACTGGACC
GTGCTCCGCAAGACGCACGGCGTCGAGCTCTTTGAGTTTGACCCGTCGGCGGCCACCACGACCAGCGCGAGCCTCGCCAGCAGCTGCACGCGCTTGTCCA
CTGTCGCGACCACGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCGGCGTCGGCCCACCAAACACATCAAGACGCGCTGCCCTCC
AATCGGTCGTCCGCGCTGCCGCACGGCTTCCAGACGCAGTTCAAGCTGCCCAACCCGGGCATCGACATGGCCTACGCCGTCGTCGCGCAGTGCGAGCTCG
AAGGCAGCGTGGGCGACGTGCTGGACGCGCTCTTCAACGACGAGCCGTGCGAGTTTGAAGGCAGCATGAAGGCGCAGTGGCACGGCAAGCTCAAGCGCGG
TGACCTGCTGCTCAGCCGCAACGTGCGCGGCCGCTCGCCCACGTTCACGTCCACCATCAACGACGACAGCTCGCGCTCGAACGCGTTCGATCTCGACGAG
CAGCTCGTGCGCGAGCCCGGCCGGCTCGCCATCAAGACGGCGACGGTCGGGGCTGGTCTCCACTTTGACCGCAAGCTGCTCGGCGCCGAAAAGCTCTGCT
A