Description :
From Genome Similarity Track
Location :
contig_38:62048- 65039
Transcript NameFunction/comments
g8690.t1POM73604.1 GPI ethanolamine phosphate transferase [Phytophthora palmivora var. palmivora

Sequence
2991 bases(100 bases per row)
CTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGCATCCTCAGCATATTTGACATTCACTTCCAATCGCCCGTGGAGTCCTCGATCCCCAGTAACGAGT
ACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCACGCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGCACGCAGACCGCTA
CGATCTCAATGCGGAGAGCGCCTCGACGAGCACCAAGTTCGCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGCGGCAGTTGGGGC
GTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCCACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCAAGAACTGGAAGC
AGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAGTAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATGCTGGCTAGACACGCCCCGCA
AGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGATATAATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAGATGAAGGATTTA
TTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACAAGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCACCGACTTGCGGG
ACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAATATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGATGCGTACTTTGGA
AACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATGGAATGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACGCGGACGGCGATCA
TTGCGTGGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAATAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTAAAGCTGAGGTGCA
GGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCAGCACAAGAATGGAGAACGCTAATAATTTCAAGCGCAAGGATGTGATGCAGATAGACGTTG
CACCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCGAAACTCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAGTATCGTGTGAATGC
CATGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTGCGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTCCCTACGCACCACTT
CACAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAGCCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCACAACGAGGCACACC
ATGTCATCGAAAATTGATCCAGGAGATGATCGATATCTGCCGGAATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTGCTAGGATCAGTCATT
CTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCTATTTACAGCCCCAAAAATTCCGAGTGTCGTGGCTGTTGGTCCACATGATTGATGTAAAGT
TTGTTGCTGCTGTGTAGTAGTGATGTGGTGGCGCTTTTTCGCCAACTCGCCATCGACATACTATCTGTATGGACTGTGTCCTCTTATCTTATGGAATTTC
GTTTGGAACTATCGCGATAAACTCAAAGCTGCACTCCCTCTTGCTCAAGATTTTGGGTGGCAGCAGAGTGTTGAGATTGCAGCAATATTTTTGTGTCTGG
AGCAAGTTGTCCTTGGTTATCAACACCGAGCCATATTCAGCTTATTGTTCCTTCTGCTTGCGTTGAGGCCGAGAATTGCAGTTGGGCACGTTCGAGAACC
AACCCGTGGACTGTACCAAAGAGACGGTGGGAGAAAGTTGACGTCGCCAACTTTCTGGTGGTCTGCTAGTTGCCTGCTTATCGCTATATTCCCCTGTTTG
CCAAGTGACTACGATGAAAGCATCGTACTTGTACATATTGGAGCTTTGCTGACGTTGGTCTTCGCTTTCGTCGTACTCCGTGGCATTTCAACAAGACAGC
ACGTATCAAGGGATGTTCTTAAAATCGGGGTTCCACCGGTGCTAATGGCACAACTAACTCTGCAATGGACGACCAATATTCTCAGTAGTCAAGACACCCT
GCCATTCTTCCTCGCGCAGCAAATTGGGCGCTCGTGATGACACCTCCAATCTGCTTACTCGTTCAAACGAAATGGCTGAGCAACAAAATGCAGTTACCCT
CGTTCAAGGCGGAAAAAGAGAGCAACGTGGAAAACCCGCAGCCTGGTGGAGATGTTATGCGCTCGATCACTGTTCGACTCGTAAAGGTGGTGCTAGCATT
TGAGCCAGCCTTTGTACTGCTCAGCACAGCGCACGAAGTCTTGTTCTACGCTGCGCTCTGCAGCGCGCTTGTAATTTGGCTTATGCTAGAAGGCAAACGA
AGTGATACTACAGGAGGTTCTGGTCGACGCGAGGTCCAACGAGCGTTGATGTTTTTGCTCCTTTCTCAAATCTCGTTTTTCGGGACAAGCAGCGTGGCCA
GTATGACACGTTTCCAGATCTCATCGACTCGCCGTTTCTTAACTGGTTCTACTTCTTCCACTGTACAGGCCCTGGTCGTGCTGAAGCTCCTCATTCCGTT
CGTGGTGGTTGCGTGCGCTTTCCGCCTTATTCTACTGTTACCAGCGGTATCAGCGCGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTGTCACGATAT
TTGCTCCTGGCAGTATCTATGGCGGACGTACTGGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACTCCATCGCAG
AATTTTGCATCGTGAACGCCCAGATAGTCCTTTTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAA