Description :
From Genome Similarity Track
Location :
Scaffold_1553:6204- 7617
Transcript NameFunction/comments
Phypl_g13695phospholipase D, Pi-sPLD-like-10
Phypl_g13696conserved hypothetical protein

Sequence
1413 bases(100 bases per row)
ATCACAGTGCTCAAGCTGGCCCGGGACATGCGAATTCGCAAGTTTGTCGAAATGACCGGGCTGAGTTACAAGAAACTGAACGCGATGAAGTTCATTGATG
CGGCAGACACGTTCAAGGTGGCTGCAAAGGACGAGTCGACGATCCTAACGGACTTTAGCGTCTCGTACAGTCTCTACTACGAAGCGTTCGTCAGCAAGTT
CCGTGAGCAGGTTGACCCCCAAGAagtgtgcagcttctcggacTCTGGTTCCACGAGGGATCTCCAATAGAGTAGAGTGTTTAAACTTGTGAGAGCGAGT
GATAGTTCTTTTGGAGGGAGCAGCGACTTGTAGAGTTAATTATCTGGTCCAATCTACCATTCGAATGACCAGCCTCTGCTCAGGGGTACTGAGTGAATTC
TCACGGAGCAGGAGATCACCGACTCACGCGTCTCGAAACGATATCTCACTGTTCAACTTCGACGCAGTCTGCAACGACCTGTCAGTAGCAGGAGCGGGTG
ACCGCGTTAGGCTGGAGGCTTGGGATTCCATGTTCGATCTGCAAAGGGTTAAGCTAGGCGAGTGATCCCGAGGCTGCAGAAAGCGAACGTCGTGGTCAGA
TCAAGCCCCCACCGGCTAATGCGACGTCAGCTTACTTGTACGAGATGATGCCGAACAAGTACTCGAACATCGTGGACGACTACGCAATTGAATCCCCGAC
GACATCACGGTGAACAAACTCGCCCGCAACGTCTGTACCCGCTCGTTCTACGAGATGACGGGGGCGTCACCTGCACCTGAATAGGCCATCTACACATCCG
TACACTAAGCCACAGCGGTTAAAGCCGACAGAATCGTCGCCCGGCAATTCAGCATCAGAGGTTCGCAACGCGTTCTCTCTCTTCTCCTGTGCAACATGGA
ATTCCATTGTGCCGACCCTGCTACGGTAATCTAAAACTGTCAGCAGTCAAGTCCAgagctcggcgtcctctCCTTAgacctgcagctggtccagcagcgc
gttgtaCTCGACGCACTTCTCGGACAGCACAAGGATTATCTGCTGGTACGtgaccagcaccttctcgacTCTGGAGTGGAGCGCCagagctcgctcgctc
tgcagctcgctctgggcttcaagctgcgtcAGCTGCGCCTCCTGGCGGGCCTCGGGCGCTCGTAGCTGGTCCAGGACGCGcgccaactgctgcagctgct
gcaactgggccgcgacctgctgcagacggTCCGCCGAGCTCAGAATGGCcgcgcgcttgagctcgtcgccggctctggagctgctgtgggCGAAGGCGCT
CGCAGacgtgagctgcagctgcccgGCGTGCTCCTGGTCTGCAGGAGAAGGGGGAGAGACGTTAGGGATTCTTTAACTTTATACGACGTGGAGGCAAGCT
ACGCACAGAGCCC