Description :
From Genome Similarity Track
Location :
Scaffold_145:62032- 65522
Sequence
3490 bases(100 bases per row)
TTTGGTTAACATTAAACAGAGCTCAATTTACTTCTAAAGACACATACTATCTTTTCCGGGAAGGGTATTTGGCCTCCCGACGAATAAAGATCCGCGCTAC
ACGTCTACACAAGTGTCGCACCTGGATTGTTTGGCCAGGTGCGTTTAAGAACTCTCAAGACACCAAGTCAACTGCGATCGGACGCAGCAAACACAGCAAG
CACAAGGGATGCAAGATCGCGAAACGGCTCAAGTGCTCAGAAGGATCGCAGGATCAAGCATCACCGTACGACAAGGCGATCTGTATCAGATAAGGGCAAC
TCATACAGAGACCCACCCAAAACCAACGCGATCGTGCGAAGATTTCCACGTGGTCGACACCAATCCCAACCACGTCCAAGTTCGACATCGACTCGAGTCC
ACCTGGAAGAGTTCAACCCGCCCTACCGACGGGTACACAAGGTGAGGAAGGCAAAGCACACAGAATAGGAGCACCCCCTCCGTTAGTCGGTCGTCTGGGC
GTGTGTAGAGAGTTGGGATCGCCTCAATAAATGAGCGACCACTCCACCACAATGGTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAGT
CCCTTGGAGAAGATGTCAGGATCAAGATTGAACCTGGGATTGAAGCATCAGCAAAAGAGATAACGCCGCGGACGCGTGAAGATGAAGGATCTCCACATCA
ACTAAGTTTTGGGAGGGGCTTTGATGAGAAGAAAACAAAAGAGGAAGATCGATCAATCTATCCGGAAGAAAAACTCCAACCCCCTCCTGAGGTCCCTTCG
GGGACCACCGCGGATCGTCCTGCAAAACAGGATTCTCTGGAAACCGTTCGGTTAAAACAGAACAAAGTCTATCCAAGGTCAATCCGGCAACTTCAAAAAA
GAAGAAGTCGAAGACTGCACGGGTGAAGAAGACAGCGCCAGGATCGGATCACCTAGATCGCGTGACGGGATCGGTGAGGGGAAGATGGAAGGCTGGCAAC
TAGATCAGATGGCGGAAATGTATCACTGGAGGACGCTCAAGCAGTTCATGCTGAACGATCCAATGCTTCGGATACTAAAGCCTAAGATGATTGGAACAAT
TCAAGTCCCTATATCAACCTCAGTGATCGCGTCGATACACTAAATGGAATCAATGGGATTATACAGCTGCTGAACGAAGCGGGATTCGTCACGGGACCAT
TCGACGCAAGAGAGCTGTTGGATTGCGAACAGGATCGCGTGATACACGCGTGTCAATCGCTGTATGAGAAGTTAGTTCCTTTGACGGGCATACGTAAAGC
TGAATATCACGCAGAAGAGACTGCGGCGAACGATCACGTGGAGCCGAAGGCTGCAGAAGTTCAGAGCGGATATCACACTCAATCGACCCAGTATGCCTCA
GCCGAATCTGAAGTAGAGTCAGGGGACTCAAACGGTATTCAGCGGATGTCTTTAGGCCCAAGTGAAGCTACTCATCTGCGCGATCACATGGAAAAGAAGG
ATGATCTACGTGGTTGTGGGGAAATGGTCGAGAGCGGAGCGCGATCAACACCCGTACGCGCTAAAGAAGATGTGGGTTCGACTACCCAATGACAACTACA
ATCATATCTTGATGCTGACATAGAGCGATTTCAGCAGGAACACCGTAATCAGGCCCGCCAAGCAATCTACCCAAGCCAGAGGATCAAGGTTTCAAGGGGT
CTCGAGTCTTACACCCCTGGTATTGAGATGGAATCGGGGGTGATCGCATCACAGTGGCGCTGAAATGCAGTTTCGTGAAGCAGGAGATCCCGAAAACTCA
GGGCAAGCCGAGTCGAGATGACCACTTGTGGCTGATGCGGAGACAGTTCCAGATGGTGGAATTAGCGCTCCGCGGATTCGGATGTCTGCGATCGCAGAAC
TGAAAGAGTTCAATGGGAAGGAAAATGACGAGGATAGATCCAGGAGGTGGATCGGCAAGGTCAAGTCTGCATTCCTACGGGATCAAGCCCCAGATGTGGC
GAAGTGCTTAGTATTTGAAGATCTGCTTACGGGTCCGGTGAGAAATTGGCACAGTCAGCTAAGCCGATCCACTCTCCATTCGTGGAAGGACCTGCTGGAA
AACTTTCTCGTACAATATGATGATAATGGTATGTCCGTTGGGAGACAATATTAGCTTGCCAAGAAGCGACCGGGGGATGCACCCGCTGGATTACCTGTAT
CGGTTGAATGTGGTAGCAAATCGAGCAAAGATACGAATTCGAGATGGATCTCCAGACATTCGTCGTGAACATGTGGAACACTTTATTGGGACCCTGGACG
ATCGCGATCAGACCAAGCAACTGACGCTGTTACAGATCGGTGATGTGGATGATATGGAGGAGACCTTACGTGCTTACCAGCGCATGGAAGATCGACAAAT
TCAATCACTTATAGAATCGAATAAATTTCGACTACGAGCTGCACACAGCTTCTACAACACCAGCTAAACCAGCGCGTGACATGAGGCCCATTCATGTGGA
GGATGAAGACAGTTCTTCGGAATGCGACCTTAGCGGATCGGACGCGGAACTTGAATCAAGTAATGTGTTTATGGCCGCAACCTCGGATTGCACGACGAAG
TTCGGAGATCTACGGGCTACAACCGACGAAAATCGTCAAGACTATAGTCCGGATAGAGTCGTATTTAAGAAAGCCTGCACTCATTGTGATTTGAAGAGAC
ACGACGATCGTGGATACTGACGTGCCAAAAATACGGTCGCAAGGGACATACATCCGACAGATTTGTCAATGTGTGTGCAGCTTGTGGAGAGATGCATGAG
AATGGCAAGTGCCCCATGGAAGAGTTCTATAACTTGATCCGTATGTGGTACGCGCCTACCAAACATGCTGGGATGTTTCCTCCGAAGTTCGAGAAGATAT
TAAACTAGAACGCTCGACAGGTTGGAATCTGGCACGAGCCGAGCGTTCTAGGCTATGCATATATTTATGTGTCCACATAAGATTGGAGGATCAAGGAGTT
AAGGATCGGCGCGATCCGATCACTAATATATGTGATTGTTCTACAATTTTTGTCTTCTATATTAAGTGTGAAATGAGTGGACGATCATGCCCGATCCCCG
GTGAAGATGGAGCTCGATCTTGCCCCAGGGGAGTCAAGGGGATACTGGAAATATCATACCCGGGAAAATGGTTCAAACACGCGAAAGCAGTGGGCAAGAT
CAACAATGAGAAGGTCACTTTGCTGTTTGACTCTGGTGCGGAAATCTCGATCATCGACACAACCTTTGCTCTTAAGGTAGGGTGTGTGATCGACGAGAGC
CGAATGCAAGAATGTGTTGGGATTCGGGAGAGTGCTTATATGACAGTGGGGCGGACCAAGATCAAAATCACACTGGACGGATCACTAGTATACTAATTTG
ATGTCTAGGTTGGAGATCAAGTTGGTCAAGAAGCCATACTAGGTATGGACTTCATGGTTCTACAGGCATCAGTTTGGATTTGGCCGACGG