Description :
From Genome Similarity Track
Location :
contig_38:62022- 65010
Transcript NameFunction/comments
g7057.t1hypothetical protein

Sequence
2988 bases(100 bases per row)
CTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGCATCCTCAGCATATTTGACATTCACTTCCAATCGCCCGTGGAGTCCTCGATCCCCAGTAACGAGT
ACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCACGCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGCACGCAGACCGCTA
CGATCTCAATGCGGAGAGCGCCTCGACGACCACCAAGTTCGCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGCGGCAGTTGGGGC
GTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCCACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCAAGAACTGGAAGC
AGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAGTAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATGCTGGCTAGACACGCCCCGCA
AGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGATATATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAGATGAAGGATTTAT
TTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACAAGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCACCGACTTGCGGGA
CCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAATATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGATGCGTACTTTGGAA
ACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATGGAATGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACGCGGACGGCGATCAT
TGCGTGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAATAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTAAAGCTGAGGTGCAGG
TACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCAGCACAAGAATGGAGAACGCTAATAATTTCAAGCGCAAGGATGTGATGCAGATAGACGTTGCA
CCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCGAAACTCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAGTATCGTGTGAATGCCA
TGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTGCGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTCCCTACGCACCACTTCA
CAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAGCCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCACAACGAGGCACACCAT
GTCATCGAAAATTGATCCAGGAGATGATCGATATCTGCCGGAATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTGCTAGGATCAGTCATTCT
AAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCTATTTACAGCCCCAAAAATTCCGAGTGTCGTGGCTGTTGGTCCACATGATTGATGTAAAGTTT
GTTGCTGCTGTGTAGTAGTGATGTGGTGGCGCTTTTTCGCCAACTCGCCATCGACATACTATCTGTATGGACTGTGTCCTCTTATCTTATGGAATTTCGT
TTGGAACTATCGCGATAAACTCAAAGCTGCACTCCCTCTTGCTCAAGATTTTGGGTGGCAGCAGAGTGTTGAGATTGCAGCAATATTTTTGTGTCTGGAG
CAAGTTGTCCTTGGTTATCAACACCGAGCCATATTCAGCTTATTGTTCCTTCTGCTTGCGTTGAGGCCGAGAATTGCAGTTGGGCACGTTCGAGAACCAA
CCCGTGGACTGTACCAAAGAGACGGTGGAGAAAGTTGACGTCGCCAACTTTCTGGTGGTCTGCTAGTTGCCTGCTTATCGCTATATTCCCCTGTTTGCCA
AGTGACTACGATGAAAGCATCGTACTTGTACATATTGGAGCTTTGCTGACGTTGGTCTTCGCTTTCGTCGTACTCCGTGGCATTTCAACAAGACAGCACG
TATCAAGGGATGTTCTTAAAATCGGGGTTCCACCGGTGCTAATGGCACAACTAACTCTGCAATGGACGACCAATATTCTCAGTAGTCAAGACACCCTGCC
ATTCTTCCTCGCGCAGCAAATTGGGCGCTCGTGATGACACCTCCAATCTGCTTACTCGTTCAAACGAAATGGCTGAGCAACAAAATGCAGTTACCCTCGT
TCAAGGCGGAAAAAGAGAGCAACGTGGAAAACCCGCAGCCTGGTGGAGATGTTATGCGCTCGATCACTGTTCGACTCGTAAAGGTGGTGCTAGCATTTGA
GCCAGCCTTTGTACTGCTCAGCACAGCGCACGAAGTCTTGTTCTACGCTGCGCTCTGCAGCGCGCTTGTAATTTGGCTTATGCTAGAAGGCAAACGAAGT
GATACTACAGGAGGTTCTGGTCGACGCGAGGTCCAACGAGCGTTGATGTTTTTGCTCCTTTCTCAAATCTCGTTTTTCGGGACAAGCAGCGTGGCCAGTA
TGACACGTTTCCAGATCTCATCGACTCGCCGTTTCTTAACTGGTTCTACTTCTTCCACTGTACAGGCCCTGGTCGTGCTGAAGCTCCTCATTCCGTTCGT
GGTGGTTGCGTGCGCTTTCCGCCTTATTCTACTGTTACCAGCGGTATCAGCGTGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTGTCACGATATTTG
CTCCTGGCAGTATCTATGGCGGACGTACTGGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACTCCATCGCAGAAT
TTTGCATCGTGAACGCCCAGATAGTCCTTTTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAA