Description :
From Genome Similarity Track
Location :
Scaffold_642:6202- 7403
Sequence
1201 bases(100 bases per row)
CGGTTCGAAGTATAAATAGTCCGACACATGTACATTTCTAGATCTAGTTAAGAATGCAACGATCTTAACCGAAAAGAAGGTGTTGATCCGGATGGAGCAA
TCTAGAACGGGTTAAGGCCGTTAGAGTTGATTCAGAGGGAATAATATGAGACATGTCAAAACAGTTATGGGCTCAAGGTCGATATGGAAAATGGATGTGT
ACCAGGTCCGCGGGATGTCGATTTTAGTATCGGGTCGACATGATTCCCCGCGACGATAAATAAAGTATTCGATGAGACGGCCGAACGTGATGAATATACT
CCGTTGGTTGTATGAAAGGATGCAATGAAAGATTTAGGATCAAAAAGAGTCAGGGGGTAGCGTCCAAGGCAACATGGCAAAGTGTATTCTCGATAGTTGG
ATATATTCTCGACATTTAGATATGTCACCCAATATTTGATTATATTCTCGACATTTGGTTATATAAGCCGATAGTTGGATATATTCTTGATTTTGGAAAA
TAGTGGCAATATGGCAAAAAGGTGTCATTATTGGAGTATAGACCTTGAATTTTCGACACGTGTTTTATAGAGCAATCTGGTAGAAGTGATATCAGCTCAA
AAAGTATTCTGCAGGGTAGAGTAGGCATAGTGAAAGTTTTTCGCTATTAATTGGTTGGTAATAAACAGGCTTGAATTCTACTCTATCTACACGAAACGCG
ACCCGCTTATCCGGGGAATAACATCTTTGGATTCCCGACGACCGAAGGCGCACGTCGCCTAAGGCACAGAAAACCGATCTTGGATCTTTTGGCCTAGATC
GCGAAGACCGATCCTGTATTTTTTGGCCCGGATCGCGGAAGTTCTCAAGACAGGACCACTGCTATCGGACGCACCAAACATGGAAAAGGACTGGTGACCA
AAACGGATGAGGCGATCTGGCACATTCCGATCTTGCGATCTTAAGGTGCGATCAAGCTTACAAGGAAGCAAGCACTGAGACCAAGTGGAATCAATCGTTT
GCGAAAAGAGCCAAGCGAATTCAAGGCATATTGAATCGATTTCAAGTGAGATGACACAAGAATACCCTGATTACTCCGTCAAGATTTCCACACCGTGATC
ACCCTCATCCAAAACTTCAAGCAAGATTGACATCTCCCAAGACCATTTCGAAGATCTCAAGCCAGCCCAACCGACGGGTACAAAATGTGAGCACAAGGCT
A