Description :
From Genome Similarity Track
Location :
scaffold_940:6201- 7654
Transcript NameFunction/comments
Pl_101802hypothetical protein PHYSODRAFT_313509

Sequence
1453 bases(100 bases per row)
TTCAGCCCGCCGATGCACACCATCTTTGACTGAAGAAACTCTTCAAGCCCCTCTGGAGAGCCTTCACGACCAATTCCCGACTCCTTGACCCCACCAAACG
GAGCTTGGACAATTGAGACCACCCCAGCATTGGCTGCAACCATACCAGTCTCCAGTTCACCCGCAACGCGGAAAATTCGACCCATATCCTGCGTGTAATA
GTACGCAGCCAAGCCAACATCCGTGTTATTTGCCTCTCGAACTACTTCATCTTCACTAGAAAACGAGTACAGTGACACCACCGGTCCGAAAATCTCCTCA
CTCCAAATGCGCATTTCCTTGTTAACATTCGCTAGCACCGTCGGTTCGTAGAAATTCTTGCCAAGGTCGTTGGTTTTCCCACCTGTGAGAACCTGAGCAC
CGAGTTTCACCGCATCATCTACCAACTCGGCCACATTTTCCACTGCTTTTGGCCCGATAAGTGGACCCAAATTCACTCCATGCTCCAGTGGTAGACCAAT
ATTCAATTTCTTGACTCGATTAACCAACTTGGACGTGAACTTGTCGAAAATTGAGGCCTGAACGAAGATGCGGTTGCAAGTCACACAAGTTTGACCACTA
AAGCGAAATTTGGCCGCAATAAGCCCGTTTAAAGCTTCCTCCAGATTTGCATCCTCAAACACGATGAATGGTGCGTTGCCACCAAGCTCAAGAACGACGC
GCTTCACGGTTGAACATGCCTGTTCCATCAGCATTTTACCTGCCCGAGTTGATCCAGTAAAAGCAAGTAGCCGAACATCGCGGTTATTTGCCAATTCTTT
CCCAACATCACTACCAGATTGGCTGCCTCGTGGAGCTGTCAACACGTTGATAACCCCGGCTGGTACGCCAGCATCTTCAGCGAGTTTGGCCAGAGCTAAC
ATTGATAACGGAGTTTTTCCAGAAGGCTTCACCACTGCAGCACATCCAGAGGCCACACATGGTGCCAAATTCCTCGTCACCGTCGCATAGGGGAAATTCC
AAGGAGAGATGATCGCACACACACCAATAGGCTCTTTCATCACCAACACCTTCTTCTTAGGATCGGACGGGCTTATCAAATACCCACTGCAACGCACGAT
CTCGTGAGCATAGTATTCAATAATACCAGCAGCGAAATCCACTTCTGTTCTCGCCTCAGAAAGAGGTTTGGCACTCTCACAAGCCGCAATAATTGCAAGA
TCATCAGTATTCTCCACAATCGCAGCGTGCCATTTCATCATCACAGCGGAGCGATCCTAACCAAACAATGATGAAGTGGCAGGTAAATGAGTAGAAGTAT
TTGAAAAATACTCTCGAAAACTTACAGGTGGGGTGACTTTCTTCCAGTGCTGTTGAGCCACAAGCGCTGCAGCGACAGCTTCGCGAGCTTCTTCTCTTCC
CATACAAGCCACTTGAGCCAGCTCTTCGTCCGTGGCGGGGTCTGAAGCGGAGA