Description :
From Genome Similarity Track
Location :
Scaffold_3480:62- 1657
Transcript NameFunction/comments
Phypl_g15855hypothetical protein

Sequence
1595 bases(100 bases per row)
CCACACAGGATTCCACTGAAGGAGTTCACCAGCCTTcgcaagaaggccgagaacAAGGGTGGCTTCACCCTGTTTGGGGTTACCCCTGGGTCCTGCCCGA
GAACACCTTGACGAAAGTCGAGGCGGAGGACCTCTTCTGGAAGTGGGTCTCTCTTCGGGATTATTCCGCCCAGGAGCTCCGCGAATTCCGTGAGGATCGC
TTGCTGTTCTATGTCTTCGACCAGCGTGGTCTGCGAATCGAGTTCGCTCATCTCGTGAGTAAGAGGAAGCTTCACTCCGAGATGGAGGGACTTAagcgtg
ctgctcagtcCGGTGCTCGTGACAAGAGCGGATACAGTATCCATTCGCCAGGAACCGTATCCCGTTGGACGGCTAAAAAGTCGCGGACTACTTACGATGT
TGCTGTCGCTTCTGTTCCCAGATCGCGACAGCCTTCGAGCTGTCAGCCTGGAGCCGCTCGATCGGCTCCCAAGAGTTTGTGAAGGAGGATAACCGCTCCA
CTTCACtagaagctggcgcttccCGTGGTGCCACCCCTCGCGGACCGCACACTCCACCTGGAAGAGGGGATTCCTGTCCCGGTCGAGCAGTACTGGGGGG
GGTCTCTCACGACCACTCCCTCGAGTCGCCTGCTGCGACGAGTGGCTCGGGACCTTCTCGGCCCCCGAACTCGGCactcgctctgctgcagcgggacCTT
GATGCCCTCCAAGAGTGTCTGCACGCTGTGGAGATGACACTGGGCGTTGGCCCTGGTGGCCAAGCCGCTTATGCAGCTGGACAGCACGACCGATTGAACC
GCCTGTGGAGCCACGTCGACTCCCAGCATCGTGCGATGCACGATCGGGTCGATCGCCGTGCTCGGGCTGAAGACCTGTCACGTCTGTCGAGTCGAGTCGA
CCAGGTTGACGACGAGGTCCGTTAGCTTCGTCGCCCGGACCAGGGTTCCGCGAACCGTGGAGCTTACCAACAGCCTTACGTGTGCGGTCAGTGGAGTGCA
CTGTACTCGTACCAGAGTTCCTCGTACGGAGCTCGGATGTACGCGCCTCCAGcgtacgagcagcaggagtacCACCGCGGGTAtccgacgacgccttcgt
cgctctcTGGTGAGCGCCCGGCGCCAGAGACGCAATTTCGTTTCGAGGAGGTGCACTCGCCTCCTCGCGGCCCGCTTCCGCTTTCTGCGGGGCAGCCTGC
CCCTGCGGATCGTGGTACCGCTTCAGACGGCCCACATAGAATGTCGGGTGGGTCGTCATCGACTTAGGCAAGTCGATCNATCCGTGCCTACTCAGGTCCG
CGAAGGGTCCAATGAAcctgtgcttcagcttgttgctgccgacAGCACTAACAGTGTTTAGAGATAGGTTCCTCGTGTCTAGGAGTACTAAAGCCCCCCT
CATTAAACACGCTTAACTTTCCTCTTGCACTTCGGTCAGAATACTCCTTTTGCCTGTCCTGGGCCGACTCCATCGCGTCTCTAACCCGGTTGATGACATT
CAGCCTGTCGTTACCAAACGACGTCAATTGCTTGCACAATACAAAAGAaaggtcgcttgagcacttgatgtCAGAATGCAAAGTAAGTTGATTGA