Description :
From Genome Similarity Track
Location :
Scaffold_2373:62- 1507
Sequence
1445 bases(100 bases per row)
GTCCAGCGCGACAGGAAGGGCCCACTTCAAAAGTCGGTCACCGAGAGACTTGGACGTCATAAGTCATTTGAGGATGGAATGCCGGGTATACACGATCAAC
TCGCTTCCTGTGACCAGCGTGTAGAATGTGTGTCAACACCCGCAGCAGCGCGGGCACTTCCTTTTCCGATTCGTGATATCGTACCTCCGCGTCGCGCAAC
GTCCTTCCCGTAAACCGGACTGGACACCGTTTGCCGTCGTGTTCTTGTGTGAGTACCGCGCTGACCGCCCACGAGTTATCGTGGAGGATAATTTGCAAAC
GGTTTCTGACGATCCGGATGCCGGAGGACTGGTAGCGATTGGATCTTCTGCTTAAGCAACTCGAAAGCCTGCTTCACCCGCTCTAGATCCCAACCTGCAC
GGATTTGCTCGTCCGTCAACTCGTACAGCACTAATGCGATCACCGAGTAGTCTTTAATGAACTTGTGGTAGTAGTTGAGGCTTCCGAGAAAAGACTGTAC
GCCTTTTAAGTTCGACAGGAACTGCAGCTTGTCGATACCTTTGGCCACCTTGGCCAGCGCGCGAAGACCAGACCGGCTGACTTCATGAGACAGGAACTGG
ACCGCCCGCTTGCCGAACGAACTTTTCGGCAGACTAACGCTGAGGCCCCAGTACCTGATCCAGTACAAGAGCCGGTCGGCGATGTCGCAGAGCTCGTCCC
ACGCGCACGTGCCGGCCGCAATGTCGTCGATATACGAACTCTTGCCGAGGATCGGACCCATACAGGCCGGAGCCGGGAGATTTCGCTGAAACACGGTTAG
CTCGTCTTCTTGTCCGTCACTTGGTTGGTAGCTCCCGCTTCCTACGTCGCCGGAGTCGGCCATGGCGTCTCGAACCAAGGCCTCATCTCGCTTCACTCCC
ACCCCTTCGAGAACGTCGGGGTCGACTTCGGACTCTAAAGCCGGAGGTAGGCGGACGAAGCCCCACAAGCAGTTATCAATAACCTGCTGCTAGATGAGCG
GGGCGTGCTTGAGCCCGAAGGGCATCCAAACCCACTGGAAGTGACCAAGCGGGCAGATGAACGCACTAATGTGTCTGGCCCTCGGGGTCATGGGCACAGC
CCAGAAGCCACTGGCCATGTCAACGCTTAAGAACTACATTACCGCTTCGAAGTCGTCGAGCAACTGGTTGTTAGGCGGCAGCGGGTAGCGCATGAGCTGG
ATGAGCTGGTTGACGAAGCGATAGTCGATGCAAAGCCGGATATCTTCCCCGTTCTTCTTCATGACGATCACGATCGGACTTGCCCAGTCGAAGTAGGAAT
ACTCGATAATGGGGCAATCCAGCAGGTCTTTCAGCAACAGGTATATCTTGGGCAAAAGATGCGCTTTTATCGGACGCGGTCGCTGGGCAATGGGTTTGGT
ACCTGCCGGACTTCGATGTCGCAGACCACNNNNNNNNNNTGCCGG