Description :
From Genome Similarity Track
Location :
contig_4:619972- 622574
Transcript NameFunction/comments
g1181.t1hypothetical protein

Sequence
2602 bases(100 bases per row)
TTTCCCTCTTTGTCTTGGTGTTTGTATAGGCAGCAACTTGAGCACGCACTCGAAGCCTTCACCATGTTCGAGAAGGTGGTGGAGTCGGTGCTGGAGGAGT
ACGTGAGTGAGTGGGTGGAGGGTCTGGACTCGGAGAAGATGAAGGTAGCGCTGTTCGCGGGGAAAGTGGAGTTCCGCGACTTGAGGATGCGTGGAGCGGC
GCTGGACAAGTTCCAGCTGCCTATGAAGATGAAGTCCGGTACTGTGGGCAGACTGAGCATCAAGGTGCCGTGGAAGAGGCTGACGTCGCAGGCTGTGAAG
ATCAAGATCGAGGACGTGTTCCTTGTTGTGGAGCCGACGAGTCAGGGTGAAGCAGGGAAAGGTGGGAAGGATGATGACTCGTATTTGCTACGTACGCGAT
GGGCAAAACAACAGGAAGTAAAAATGTTGGAGTTGGTGGAGACGATGAAGAGTGATGGAGCTATTGCGAGTGGAAGTGAGACTGAAGGAGACGTCGCTGG
AGCTGCAGACTCGGACCCAACTGCGTCCTGGGGGTACCGCAAGAAGATTCTGAACACGATTTTGGACAATGTCTCGTTCGAGTTTTCGAATATTCATATT
CGGTACGAGGATTCGAGGCACTTGGCGTCTTCAATTCCGTTGGCGCTGGGATTGACGATCGATTCCATTGTAATTTCATCGACGAACGCGAATGGACAAG
CTGAATTTGTGGATCGAGCGCAGGCTCGCACTGCGTTTGTTCATCGGCGTCTGGAGATGGTACAGGCCAGCATCTACAGTGACAATGTCGAGGTGTCAGG
GGCGAAAGGAAGACAAGGCCCCTCAACTTCGGGCTCAAATATCGTTCATCCTTTCAGTACTCGAATCAATCTTGCGCGAAATCATGATCAGCGGACTGCG
GCCACTATCCCAAAGCTGCGATGCTCGGCTGAGATCAGTGCTATTAGGGCGTGTCTAACCCCGCAGCAAAGCACGTTCTTAATTGGCATGGCAGACTTTG
TGTCCGCCCATGAGATGTACTTGAAGCGTCTTCATTTCCAACGCAAGCGCCCCAACGTTCCTATTCACTCGGGCGCTCGGCTGTGGTGGCAATATGCACT
GCACGGTGTTCAGGAGTTACACCCGAGCACGCTGGCAGGCCAAAAGGCAGCAACGACTGTAGCCGGTGGAAATTCATCTCGTAAGTCAAGTGCTGTCTCT
CGTCGGTGCAACTGGAAACTATTTGCAACACTGTGGTTCGCTCGAAAAGAATACATTCGTTTGCACAAGAATATGCTGCGTGCTGCAAAGAAGAAGAAGT
TGGACGTTGAGAGTGTGTTGGCTGATCGAGCCCGGCTTCATCAGCTCGAGGACATTTTAGATGTGGAGACTATTGTCTTTTTCCGGCAGTGTGCCACCAG
AGAGATTGAAATTGAAGGTCAGGGGCATGATTCTCCTCGAAAACTGGCCCAGTGGAAATCGAAATGGTCTTCTGGAAGGACATCGAGTGGAAGTTCCAGC
ACCGCATCATCAACTCACCGAGAAAACACCTTGGATAAACTGGATATATATTTATCAGTGAACGAACGAATGCACGCATCATCGGAAGCTCGTACCCCAA
GCTCACACGAGGAAAGAAGCATAGCGGCATTGCTGATGGCGTTGGATCTGGTCGTCATCAGTTTCGAGGTTGTGCTTGTCGAGGAGTACAAGGTCGGAGA
CCAGTCGGACACCCGAGACTTCTTGCGGTTTGAGCTCAATGAGTTCGTTGTGACAGTGCTGCAGCGTACGAGTTCATCAACTGTTTCATCGCGTATCACA
TCTGTTCAGATCCTCGATTTCCGTCAAATGTATGAAGCTGCTTCGCTAGAGAAGAAGGAGCCGCAGGCTCTTTTGTCCATGATAGATTCTGATGTGTCGA
GTGGAAATATTACGTCACGCAAGAGTCCGTTCGTAGAGCTCAACATTGAAACCTCTGAGAACAAGTTCCAACTTGATTGTGGTTTTGAGCGATTCCGCTA
CATCCACAATCTGTACGCCGCATCGAAACTTCGCGCATATTTTATACCGAGAGCAGAAGATATGGTATTATCAGTTCCCGTCAAAGTCGAAGCACACCCT
GTACTATCCAGACAGGCGGGAAAAAAAACTACTGAACTACTTCGAAAGACCTCAGTTGATAATGCTTTTGGCGTTTCTAAAAGTTCCGAAACTCGCCGAA
ACAGCAATGTGGGAACTTCTCGGCCAATTCATACCAAAGAAATCGTGTTCTCGGTTAAATTCCCCGAGATCGACGTGTTTGTCCATACGACTGATGCTTC
AGCAGAAGTCGAAGTCAGGCTCGTTGGAACGCATTTTCAAAATGGATCAGCCCACAACACGTTTGAGTTATCAATCGACGGCGCGGAGACCTACTTTTTA
GATGCAGATGCTTCTGAAGAAAAAAACTTGAACAATTCATCTGCAACTGATCCGAATCATAGGCAGCGCGCTACGCTCATGAAAACGGCTCGATTAGTAT
TTTACGGTGAAAAACTCGTGGAAGGCTACCTGGTTCCGAAGTGGCAGATGACCTGTACAGCACCACCCATCCAGTTTGCGATGTCCAGTAAACAATACCA
AC