Description :
From Genome Similarity Track
Location :
Scaffold_30:619944- 622142
Transcript NameFunction/comments
Aphas_H257_10178conserved unknown protein
Aphas_H257_10179putative glycosyl hydrolase family 6 protein

Sequence
2198 bases(100 bases per row)
TCGCGGCCAATCCCGTGGAAGTGAAAAAACATGATCTCGTCAAACACACACGACAAGGATTTAAACTTGGCGTGGGTTTTTTGTCGCTTGTCGAGCACTT
CGACGTAGCAAATGGGATCGGACGTGCCGTCAAACTAGAGATACACTTCAATGCGAGGACAACGAGAGACACAGGTGGACGTACGAACTCGCCCTTGATG
TCGCGAGCTTCGATGATATGCGCCTGGATCTGGTAGTCGCCCTTGGGAACGTTCGACATGATGGCGTCTTGGCGCTGTTTCTCTTGCCACTCGAGCTCTT
GTTTCCGAAGCAGTGCTTCTTCTTCGGTCTCGTCTTGTTGGACAGCGACGCCTTCGCCGTCGCCCGTGTCCCACACGACGATGGCGTCGCTGCTGTCGTC
CGCAGAGCGCTCTGCGGCTTTCATGCTATGCAGCACCACGGCGTCGTGCTCGCGCTCGTACACGAGACACACTTTGAGTTCGAGCTCCCCCAGCGGTTTC
TCCCGTGCTTCCCACGACTTGTCCAAGAGAGGAAACAAGCGTGTGCAGCGCATCATGGGCTCTGTCGCAATGTCCGACGCGACGATGCGGATTTGACCCA
CAAACCGCTTCTTGATGTTCACTTTGTCCGCCACGGTAATGGTACATGCTGTGAGAAAGTCTGGGCTCCGAAACGAGAACGTCTACACGCATGGCGATAT
CATCCAACATGAAGGAGGACACGTGAAGGAGCGACGTACTTCGTTCCACAGCGGATCCAGTGTCTTCGCCTTGAGTTTGGTTTTGTGCTCAATGCCGGCA
CACGACAGCTTGCAGTACAGGCTCGTCGTCGATCGGAGTGCCGCCATGGCCACCCCACGAGCCCGGATCACCGTGATTCGGAGGGTGTTGGGCGGCTTCG
TGCCTTCAGGAATGTCTTCAGCCTCATAAAGTCGGATGGACGGCGGTGCAGCCGCCGCAGTCGTCGACGCTCTCGACATTTGCGCGCGCAACTATCGATG
GCGGTTGCCAGACGGATATTTTGTCCTTGTATTTGTATTGGTATACAAAGGCTCGTCTAAATGTCGAACAATTCAAAACTACCTTTGAGAACTGATATTC
GAAGTACCAGGACGCCTTGCAAACCGGATTTGCATTAACGTTAACTAACCTCATACAACGTACTACGTAGTATACTAGTACTATATTAATAGTTACATGT
ACAGTAATACAGCAATCAACCTTCTGCGGTTTGATCTATATAACTCACCACAGGATGACTTCATGTCAATTATGATTCTGACATGGCACAGCTACCGTAG
AGCTGCTGCACGTGAATTTTTCGCTGCTTTGACGAAGACCTCATCCTCTTCGGTATCGCTGCGTGACATATTCCAACGTGAGCCTGTGTTATCCTCAGAG
GCACGACCTCGTTTGCCTACAACGACAACTTTGACATTTTTGTCGCACATCGATGGGAACCGGCATGTTAGTGACAAAAGAATGACGTGGCTCGTTGTTA
GCATACACTTCCCCTTCGTGGAGGGAACGTAGAAAGTCGGCTGTGTTGGACGATTCGATTGCCTGTCCTGAGCCCATCTACATCGCGAACATGATGATCG
CGACAAACCCGAACCTGCATCAGCTCGTGTCGAGCAACGCCGAATGTGTTGCACCCACGTGATGCAAAGCCCCAGCTTGCTGGATGCTCGTTGAGCGCAC
TAATTCAGTTGATCACTTTTGAAATTGGCTTGCCTCGACATGTTTCGTTCTTTCACCCTTGCCATCCTCGTCGCCACTGTGGCGTCGTCCGCCGCCGCCT
CCGTTGGCCTGTGCTCGACCAACAAGCCATACTCGTACTCTGTAGCCAAGTCCCAATACCCGCACTTGAAGTCGGCCATTGAAGTCGTGGAAGGCCAGCC
CATTGCCACGTGGTACACGGATCGTTCCCAAGATGCCAAGACCCAAGTCCAACTCACCGTCTCGAAATGTCCCGCTGGTAAAATATCTCTTCTATTAAAT
CATAACTTGTGGAACTAAATACCACGTGGAATTTAATATTTGCAGGTGACCGCCCCACGGTAGTGGTGTATGGGCTGCCCAACAAGGACTGCGAAGGCCA
CCAGTCGGCAGACGGCAGCAATAAGACGCCTCAAGATTACGTGGCTTTCTTGGAGTCCCTCGTCACGGCCGTGGGCAACAACGACGTGATCTATATCT