Description :
From Genome Similarity Track
Location :
Scaffold_755:6199- 10305
Transcript NameFunction/comments
Phypl_g10775hypothetical protein

Sequence
4106 bases(100 bases per row)
GCGACTACAATCTGATGCTGAAGAacgaccagctcgagttCCTCTCGCGTATGCAGATCGCGAACGGAATCGGCGTTCAGCGTCCAGCGCAGCGCACACA
ACGTGAATACATCAAGGTCCtaacgaagaagaagcacgcACGCACCAAGGCCGACATTGACATGCTGAGCGAGTATCTTCAGACGCTCAAATTCTTCCGA
AGCTTGCCCAAATCCTTCGTTCGggagctctgcgtcgtcgtcgaatTCCTCACTCTGTCCGCCGGAGCCTGCGTCTTCCGCGAAGGTGAGGTAGGAGACT
TGTTCTACATCATTTTTAGCGGATCTGTGGACGTGAACATCAACTCCAAAGACTTCAAGGGCAACCTGCAGATGACCAAGCTCATCAACTTGACCGAGGG
GTCGCACTTTGGCGAGTTGGCTCTCATGAAAGGCCGAGGGGTGCGTAGCGCGACAGTGATCACGCGTGAGGAGTGTCAGCTCTTGGTGATCTGTGAAAAA
GACTACAACTCCACTCTGCGTCGAATGCAGAAGAAAGACATGGCCAAGCGCGTCGGTGTTCTGGACCAGATCCCGATGTTCCAGACCCCGGAATGGACAG
gagagctgctcaaggaaCTGTCTTACGTGTTACTGGAGCAGAAATTGTCGACTGGCAGTCTGCTCTACCGCCAGGGCGATCGTGCGACGCACGTCTATTT
TGTTGTTCGaggcgagctcgtcgtcaccaaGGAGATCGCTGATCCCTTCACACAAGTCAAGCACGAGGTGTTCGTGGAGCGCATCGGCCGCTTCCGTGTT
GTCGGCGACGATGCGTACGTAGCCGTAGCCTGCGATGTTCGCAGGTAATTATTGGACTGCGTTCTGACGAATTGTTCATTGGATTCGtgttttttgtgtg
tgctTGTAGAGCTGCAGGGGTGACTTTCAACGAGGTGATCCAGCGAGAGGTGACCGTGAGCGCAAGTACTCCTGTCGAGGTCTTGCTGCTCTCCAAGTAC
GACGTCTTCCACCGCTTATCACGATCAGCTCGAGAAACGctacgagctgcagctcaatCTCACGCGGAAAGTATCGTATACTTGGATCGATTCCACAAAA
CTCAAAAGTGGGAGGCTTACAAGCTGAAGGTACTTCGGGAACATGTTAACCATGAACGGATCGAAAAGATCCTGCCctccgcagctgcagcgaagcGTAA
AGCTGCTAGCAGGACCACACACATCGGAGTTCCTGCAAAGACGCCACAGTCATTAAAGGACGTAAAAGCTAAACTTTCGGGTCCTGACAAATCTGGATCG
GAGAAAGGTTTAACATCCGCAGTATCCACTGCGGGCGTCACGCTGCCAGCGTTGCTTGTCCCTTCTTCGGTTGGCAAATACGGCAAAGATGACTTTGGTC
GCCCAAGTCGCACAGTCTTGAGCAACACAGCGAGGCAAGCTCTAGTCCCAGCCAACGAGCTACTGCTGTTGGCACAAGaggcgaaggcgatgaaAAAGTG
TTTCCAGCCGGACCAGACACTCGGTAACTACGTTGCGTCATTCAACGCAGACGCGCCTCCCAGTTCCGCCCGACAGTGCCAGTTGGATGGTGTCCTGGCA
GCTGAAGATCGTCGCCAAGCTGAAGTTTTGAACGAGGGCAATCCACTTGCATTTTTCGACATCAAGGTGGTCGAGAAGCAGAGTGGGGCGTCTTGGAACC
GCGTTACAAAACCTGTGGGGATGGAACagcgagaagatgaagatgtAGACCGCGCCCACGCTGTTCCAGGTCTTTCGTCAGGGTCGCAGCCTTCTTCAAC
TGCGCggccttccagcagaagccTTAAAATCAATTCTCAAGCGCTAAGCCAGCTCTTACAAGAGAACTTCATTTTCTCTCGTCCGAAAGAGGCCAAACCA
CGAGGTCCAGATGCTCGGAAAACAAGGCTATTGCAGTCGAAGGCCAAGAGCCCCGTTCGAAAAGTTTCCTCCTCGTCCCCGAAAGCGCGTTCCCCATCAC
GATTCAATGGGGACCGGGTGCAACTTGACTGCGCCAGCGAGGTGGGCCACGTGCTATTTACCATTCTGAACGAAGACAGTGAAGAGGAACCGGAAGCTTC
CTTGGTTCCCATGAAATCGCCAGCTTTCCAGATTCTGCAGTCTGCGCGGTCTTTCAGTGCGATTCGTGAACAAGTGGCCGAGCGAATGCAGGAGAGTGCC
GGGGTAACCAGCTTCAAATACTACGCTTTGCCACTCAAAACGTTCGCGTTGCTACCTCGTGTCGGCCGATTGAAAAGTGACGAAGAGCGGCTTCAAATGC
AGCAGATCGGAGAGATGGCAGACGGTGATCAGCTGAGGGTGCGGGCGCTGTCAAGTCAATCCGTTGGCGAGTCCACAACCTCTTTGCAGTCCACAGCAGG
GGATTCGTCTGTGCAGTTCGCGTCATTTCAGGAAATAGCCGTCTCCCTGGGTTCGAATGCTGCTGATACCGACGAAATTCGAGTACCACTACCAGGATCT
GCAGTCGAACCTGCTAGCCCTGTTCGTGCCACCAGCCAACCCAGCAGCCCGCTCTCTCGAACGAAAACGTTCAACTCAGGCACCAGGAGTGTCCGAGATG
CCTTCGCAGTTGCGAGTGTGGTGCTTTCGAAACGCGAAGTCGCTCACTCGCAGTACGCGGAACCGTTCGTGGCTGTCCACGCGCTCTTTGCCTCGGAAAT
GGAGGCGGTGACCTACGCCATGGGCCTGAAGCCTTCGCACTCCCTTAAGAGCGCCATGCTTTGCATCTTTCCCCTGCGGAAATGGATTCATCTCGAGCAT
GCGCACGACTGGTGCGTGCAAGTGGAAGCAAacaagcgcgagaagcgAGCTCCGTCCTTTTCAGGCTCAACGCCGACTTCACCCTCAACGTCCAGTCCGA
ACCTGCGAACCAGGCGGTTGACACTCGTGCCAGACCCTCCGAAGCCAATCTGGCAGCAAGAACGCGACGAGGCCCACCGACTGCACAGCTTTATTTGCGC
ACGCATGGGCGCGTCAGCACTTGACAAGAGGAAGGATCGGATCGAGGAGAGTGGGGGCTTCACACCTCAGCCTCTAGTCACCTTggaggacaagctggac
acGCTTCACAACTATCTCGAGGCCACTGCTGCGTTTACGGCGAAAACTGGGCACGGAGGTGTGGCCCTGCTCAAGTACCGGCAGGTGAAGCGTTTCGGCT
CCATCATGCGCTCGCGCATTGCTGGTGCAGTACcacacaacaacaacaattCTAGTAGCCACACTagctcgccatcgccaggCTCCTCGTTTTCCACGGT
CATTCCTGGGTAGGATAGATTTTGAAGTGCCACACGTCTCACACCTGCTAGTGGTGGTGTAGTGCTTGCCCTGCTATGCCGAAGCAGAGCGCCAACATAA
AGTTAAGGTTAAGCATCATGTGGTTAATCTTTTCGAAAGCAGTCTCCAAGTCTCACCCACATTTTTTTCAACATTGGATTTCGCAGTTATAAAACGAAGA
CATTGACTGCGAAAGCTCTCTATTACGGGGAGAGCGATTGAGGTGCCACTCTCGAGTCTGTATTTCCCTTTCGTAAGCATTTCTGAGAGACGAGCATCAC
CAAGTGGTCAGTAGCAACACCGCAGACTTGGGGCTTTTAAGGGTCACAGTCTCAGCTGACAACCCACGAGTAGTAAACAAGATTTGGAGCGCGGTGGTCA
TGGACGTTCACAGTCAATCAGAGGTCGGAAAAACATTATTTTCAGGTATTGTTGGCGCTACTAACGATTGCAGTCCGCATTGCAGTATCCTCGCCTCGTG
CAATCGGGTATTGTACTGCATCGTCGCTCGCAGTGACGTATTGCAATATGGTATTGCAATACGGTCCATGTCGTTGAGTTTTGAAAactgcagaagctgg
agcggGTGATCGAGTTACCAAGACATTCGATACATGCTGGGTCATCGGTCGAACGACTGTTCTGCACAGCGAAGTGTGTTCTGATTGATCATCGCCGCTC
CATGAGCCCGTGGGTGTTCGAGAACATCATGCCCGTGAAGACGAATCGCGTGTTCTGGACGAGCATGACAGCTTGAGTTTAGGCTTCGCTAACGTGTGAT
CATCCG