Description :
From Genome Similarity Track
Location :
Scaffold_995:6199- 7984
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_995-snap-gene-0.4Renalase
Pytve_DAOMBR484maker-pve_contig_995-fgenesh-gene-0.3Gene of unknown function

Sequence
1785 bases(100 bases per row)
TGCTGGGTATCCTGGAGCAGAGCCCCGCAGAGACGCAGGCGCTTGTGTCGCCCACGAAGCTCGCAGCGCTGCAGGCCGTCGAGTACTCGCAAAGGTTCGC
GGTTGCCTACCTGTTCGACGCGTCCATCGCCGCCCACGTGCGTGCGCTCGGCTGGACTGCGCGCTATGTCTCGCGAGATGAGGACGACGTCGTGCGATTC
CTGTGCTGGGACAACTTCAAGAAACATCAGGACCCGGACAAGAGTGGCGTATGCTCGCTACTCGTACACACATCTGTGGCATACGGGATGCTCTACATGG
ACGACAAGGAGCACGACAAGGAGATCCTCTCGACTATATCCAAGTCGATCCGCAAGCTCCTCCCCTTCTTGCCAGATCAAGAGCTGGATGTGCTACTCCA
CCGATGGCGGTACGGACTCGCTGTCGGTGATCTTTGGTGTGTATTGAGAGATGTAACACTTGCTCTGATGGTCGACTCAAGAGTCTCGCAGGTGACCAAG
CGGTACCGCGACGATGCCAACACGGAGGCTCAAGGCAATCGCAAGGGGATCCTGGAGCTGAGCAGACATCCGCGCATCCTACTCGCCGGCGACGCGTTCC
TCGGCTCGAACTTTGACGGCTGTCTGCTCTCGGCTAAAGCGGCAGCAGTCGCACTGACGAGCGACGATGGCAGCGCAAGCAGTCTCTGACGTGTTCACGT
TTGATTGTTCCGGTTGATGTTGACAAAGCGAGTGCGATCGAGAGCGTATCCAATCAACACATGCGGGTGAGGAGTGTCCAATTTACTTGCGACGCTTAGT
GATGGACGTCGTCGTGTACAGTCCTGGCAAGCACTGGCGGAGTATCGGCGTCGAGGTCGAGATCATGGTCGAGGCCACGATCTTGGCCACCCGCTCTCCA
ACGGCGTGGCTCGCGCACTTGAGCAGATTCCGTTCATCATGGCTGAGTCCATTGGGACGAGGAAGCGGATCCAGCAGCGCGATGATGCCGACGGCCACGT
CGCCAGCGACGATGGCTTGTCCGGCGAAGAAGCCCGCGTTGGACAGTGTCAGGAACGGGTTGAGCCGCACCTCCTCGTCGCTCGCGGCCACATCCGGCAG
CACGATGGCCTGGTCCGCTGAGCCTAGCACGACGTCGCACATTCCGATCTCTCGCGGCACGCACGAGTAGTGCAGCATATCGCCGCAGCTGCCGACGATG
AGCTCGAAGTTGCCGCTCGTGAGGCTCAAGAAGCACACGGCGGTGCCGAAGATGCGGCGCACGTCGGTGCACGTCTCGGACCACTTGGGCGAGTGCAGCA
GCTGTCGGTCGCGCAGGGTCTGCAGCATGCGCGCGCGCTTCTTCTCCGTCGACCGCACGCGAGCGTGCGAGGACTGGCACCGGGTCGCGAACCACTGGTG
GTAGTGCGCTGGCGCCAGCCCAGGGTACTTGGCGCGCTTGCCGTTGAGCTGCTCGGTCGAGAAGAAGGAGCGCGCGAGTTGGTGCTCGAACGCGCTCACC
TTGCCACAAGCAACGCACACGCGCTTGGCGGGCGATCCGCCGCGCGGACTGCCCGACAGACAGCTCCAGCACACGCTGGTCTCGCACTGGCCGCACATGG
CCGCCCGGCGCAGCACCGAGAACGAGCGATCGCACCGTCCGCATCGTCCCGCTCGAGGGTTCGATCGCATCCCTGGTGATGCCTTCGTGGTCGCGATGCT
GTCGTAGGGAAGGGCGAGCGCCACGTTCGACGCGTCCGTAATCTCGTCGAGGTTGATGGCGGACGGGCGACGCCTGGCCGGCAGC