Description :
From Genome Similarity Track
Location :
Scaffold_29:6197- 31229
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_29-fgenesh-gene-0.1Anaphase-promoting complex subunit
Pytve_DAOMBR484maker-pve_contig_29-snap-gene-0.27Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_29-fgenesh-gene-0.3Chac2 protein
Pytve_DAOMBR484maker-pve_contig_29-snap-gene-0.43Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_29-fgenesh-gene-0.15Sorting and assembly machinery component 50
Pytve_DAOMBR484maker-pve_contig_29-snap-gene-0.31Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_29-snap-gene-0.45V-type h-atpase subunit
Pytve_DAOMBR484maker-pve_contig_29-snap-gene-0.32Peptidyl-prolyl cis-trans isomerase E
Pytve_DAOMBR484maker-pve_contig_29-fgenesh-gene-0.6Leucine rich repeat-containing protein
Pytve_DAOMBR484fgenesh_masked-pve_contig_29-abinit-gene-0.90Conserved gene of unknown function

Sequence
25032 bases(100 bases per row)
TGTATCGCGATATGTTTCGAGCCGAGCCTCATCGCATGGAAGGCCTGGACCTGTACTCGACGACGCTGTGGCACTTGAAGAAAGAAGTCGAGCTGTCGTA
TTTGGCGCAGCAGGTGACGGACTTTGATCGTCTGTCACACGAGGCGTGGTGCGTCGCCGGCAATTGCTTCAGTCTGCAGAAGGAGCACGACACGGCGCTC
ACGTTCTTCCAGCGGGTGAGTTCTGTCGTTCGGTATCCTGACCTATCGGTGACTAAATTCGAGCTTAATACTGTCGAGCAGGCTATCCAACTCGATCCGT
CGTACACCTATGCGTACACGTTGTCGGGCCACGAGTACGTGTCGAACGAGGACTTTGACAAGGCGATCAACTGCTACCGACACGCGATCCGGCTCGACGC
GCGGCATTATAACGCATGGTACGGATTGGGCACGATCTACTACCGCCAGGAGAAGTTCGAGTTCGCCGAGTACCATTTCCAGCGCGCGCTCGAGATCAAC
CCGCAGAGCTCGCTGCTGCACTGCTTCCTTGGCATGGTGCTGCACGCCATGCATCGGTACGACGAGGCGCTCGACGCGTTATCTGTCGCGAGCGAGCTGC
AGCCGCTGAATCCGCAGGCGCGCTTTCAGCGGGCCAACGTGCTTATCACTCAGCAGCGGTTTGACGAGGTGTGTGGTTGATTCTGGCGAGGCTGTCATGA
TACAGAATACTGACAGAGTTTGCATGGATGTGGGCCAGGCGCTCGGTGAGCTCCGTGCGGTCCGCGACTTTGCGCCGCGTGAATCGTCGGTGCATTTCAT
GATGGGCAAGGTGGCCAAGAAGCTCGGGCGGCTCGAGGACGCTCTGCGGTACTTCACGACGGCGCTGTATTTCCACCCAAAGGACAACAACCTCATCCGT
TCGGCCATCGACAAGATCAACGAGCCGGAGTTCGACGACGACGAACGACTGTAGGTCGCGACAGTGGCTCGAACTGCGACTGCGGCTTGAGATGGCAGTG
TTGTGTACTAATTGAATCATAGCAGCAGCACTATCCGTTCGGTGGCTTGTCGATCCGAGAGGTTCGTGTTGAACCATGGAAGGTGAAAAATGGCAGAAAG
GTTGCTCGGGAATCCGATACCACGATATAAGAGCACTTCTGACCACTGACCCGCTCTTCAATCGTGCTGTCAATCAAACCTCAAGCGCCGGCGATCCACC
AACAAGTCGGCTTGAGCGAAGCAGGTCGCATCCCATGGCGCTGTCTCCCGACCACGAGGCGGCGTACCAGATGCTAGCCATGAAGCTGCAGCGCGACGTC
AACTGTCTGGCGGACCCGGACCGCTCGGTACGGCGGCGCGCGATCGACCGTTTGCATCGCGCGCTTCACGCCGACGCAGCGTCTGTCCCTGCTGCTGTGC
TCTCCAAGCTGTGCGAAGTCAATCTGCAGGCTGCGCTGCTCGCGTGTGCGGGACAGGACACAGTCGAGAAGTGTCGCGAGAAGTCGCTGACGCTGCTGCT
GTTCCTGGTCGAGCAGCGCGCCGTCGCGCGGTCGGAGGCTGTGCTGAAGCAGATTGTGGCGCTGGCGACTGCGCGGCTTGGCAAGCTGCCGTACCCAGAA
CATACGGAGGAGATCCGACTGCTGCTTCTCCAACTGGTTGTGGCCTTTTTGAAGCAGCTTGCCGCCGAGACGGAGCGCGAGACGNNNNNNNNNNNNNNNN
NNTCGCTGCGCGATGTGATCGCCGATCTGGCGGACGTGTTGGGAAAGTCGGCTCTGGATCCGTTTCCGGACGTGAAGAAGATTGTCGCCGACTGCGTCAG
TGTTATTGGCGCATCGTGGCCACGCGACTTGGCGCTGCAGCTGGGCACGATCGTGCGGCCGATGGTGACCAACCTCGGGCACCAGCACAGTCGCGTCCGA
GTGTGTGCTCTGCAGGTCAGGTCTCTTAATTAGCTGCCTCCACCGCGTTGAACCTTGGACTGATAGTGTGAATGAATAGGCGCTTGAAGCAGCAGTACCA
TGCGGATCCGAAGCGTTGCCGGAGCTGATGAAGGAGGTGCTGCTGCCATCTCTGGACAAGGTCGCGTTCGATCACGCACCTTCAGTGAGGAAACAGCTTG
TAGCGACGCTGGCGACTTGGTTCGCGCGTATCGAGACCATCCGACAGTTTGACGCTGTGCTTCTGCCGCTGCTGCTTGCGGGTGTTGTGGACGAGTCACC
GGAGGTCCGGAGTGCGGCGCTTGCCAAGTTGAATGAGTTGTCGACGACCTGGGAACGCGACGAAGATGGCGCAGACAATTCGGCGCAGGCTGAGGCGGAC
CCGATGGAAGTGGACAGCGACTTCTCAGCGCCGCCACTGTACTTTCCGACACGCCCGCCTCATGGTGCACGTGAGATGGCGACTCGGTACGGCATGGCAC
TATTGTTACTCTGTTTACCGCATCTTATCGATGTGTACTAACAGCTGCTGTAATGTGAAGTGTCCAAGGCGACGTGCTGCCGATCTTGCTGGAGCGTACG
AGCGACTGGACTGTAAGTTTCGAGCTATCAGATGGACAACTAATGCCGGATGATTGCTCACAACAATGTGAACGAACAGGTTAGTGCCCGAGAGCATTAC
ACCAGGATTCTGAGTGCGTACTTTATCCTCGTGGAAGACGGAATGAATCCGTATCTCGACAAGATCTTTGCGGCGCTCGGCAAAATTTGTCGCGACGATG
AAGAGGCGGTTGTGAAGGTTGTGACCGAATGCTCGGGCGTGATCGGCTTCTATGCGAACTCGCAAATGGTGCTGGCTTCCCTCCTACCGATGGTGCGTTC
GTCTGCTCGAGTTGTGTCTAGGCGTCGGGATACCCGTCTAATGGTGAAGCTCTATGGCAGGTGGCTGGGAGACTCGCGGGACAAGACACTGCGCAGCACC
GCACGAACGGGCTGATCCTGCTGGGGATGAGCGTTGAAGGCATGACTACCAAGACCATTGAGCCGTATCTGGACGTACGAGTGCACCAATTCTCCCTCGC
CAATGTTTATCCGTTGCTTAGATGTTGACGTGCTTGTTTCAATTCAGCTGATCACCGAAGCGCTGTGCGACGCTGGCGTTCGCGAGTCTGAAGTCGCCGA
TCTCCAAGACCAACTCGGCTGTGTGGCTTCAAGCGTCATCCACACGGCGGGACCAATTTTGACAAAGCACGATGAGGTGTCGTTCCGCATGTTCTGGGTG
CTGAACCACCTTCTCGCAGCGGCATCGGAGTCGTCAATCGCGTTCGAGACGGTTGGTCATTTGTATAGTTCATTGCTATTGATCCAGTACTGACAGCTTT
ATCGATAGGCAACCGCAGCACTCGAGAATCTTGCAGCTGCTACAAATCACTCGAATATCCAGGTTTCATTCGCATTGCTCGATTCGCTCGGTTGTTCCCC
AACTAAGCTGAGTGATTTTGATGTTTGCCATGAGCAGGACTTGTATCAGCAGTACTTGACAAAGTTGCTGAGCAAACTGGTTCTACCGACGGATGCAGAC
TCGTGCTGGAAGAAGAACGATTCGAGCCGAGTGCTGTTCGACTCACTCTGCAGACGTGGAGGCGCTGTACGTGAACATTCACACCCGTGCTGGATGTGGA
CGAATCTGCTGTCCTTGCTGGTTGCTGACATGTTCGTGCAGGCCTGCACAGACAACGTCGCCGTCATTGTCCCAGTCGTCCTTGTGCATCTCGAGCCAGC
TCGGGACGCAGACGTCCGCCTGTCGTTCCTGGCGCTGCTGGAGACAATGCTGAGCAACGACGCCATCTGCAAGGTGGGTGTTGCCAAGTGCAAAACCACA
ATCCAGCACTGCTCACAATCTGTCTCTCTCGCATGATATCCATGGAGCAGGCTTTCCAACCGTTCAGCAAGCCGCTCTTGCTCAAGGGCATCGTTCCCAA
CATCGTGTGGCAAGGCGGGCGAGTTGCGGCGACCATCCGGTAATGTGCATTCACCACCTTTTCTCTGACATCGGTGTCTAACATCGGCGATCGTGATATG
TCCGCTGACGTCAACACAATCATTCAGCAAGGTCGCGGTGGCGTGCGCGTACACGCTTCTTCGTCAGGGTCTTGCTGACCAAGCGTGCCTGTTTGAGGCC
GCTCCGCAGGTCAGCACTTCTCTTTTCAATTTGTGTGTGTGTTGACATTCTGACTGACAAGTGCTCGCGAACCCTCAGATGCTACCGGTGCTGAAGTCGT
CCATGGATGACGGTGATGCCAAGACGCGCCAGCTGATTTGCCTAGCGCTCCAGTACTTGTTCGTCGCTCTTCCAGGCAGCCTTGGAGGTCAGTATGGCTG
TCAGCATCGGAGCTTGATTTCGTTTGGTTGTCTGACCAATTCACTTGGCGTTTCTCCAGCGGAACCTGTTCACCAGCTCTACTCGGAGATTCTCAAACGG
CTGGATGACAGCAACGACACCGTGCGGAAAGCAGCATGCCAGACGTTTGTCACGTTTCTCCGTGCCGCTCCGAAGGAGCACTTCCATGGGACGATCATTG
ACTACTCGCTGGACTGCCTGTTTGTCCACTTGGACGACTCAGATCCGGAGATTCAGGTGCGTATCCCATGGCAAATCATGGTGTTGGACAAAAGGCTTAT
CTCCTGATCGTGTGCGCTCACTGCGTCAAACAGGTTGCTGTTCTCGATGTCTTGAAGCAAGCCATCGCGATCGATGCAGCCCTAGTGGCAAAGAAGGCGC
AAGAGAATCGAACGCGTCACCAGAACCCGAGATATTGCGACGAGCTGTTTTCGCTTGCTAGCTCTGCATCGACATGAGAACTGGTCGGGACAAAGTAATC
CGAGCGCGGTTCCTGCTGTCGAAACGGGGATCACACACACTGAATAGACGCTGCTCTTTTTCAAACCACTTCGAGCTCGTGCTTGTCGAGCTCGTTGAAA
TACGCAACCAGATCTCGGATGCGCTTCTTCTCGACCTCGTCGTTCTGCCGCTGCTGCTCTTGCTGCTGCTGTTTCCGCTCTTGGAAGCGCGACTTGCCTC
GCTTGAACGCGAACGGCGGCGGAGACTCTTGACTAGCCTTGCGTTCACATAAACCGCTCCGTGTCTCCTGACGCCTCCCTGCTGACTTCTTTGTCGCTCG
TCTCTTGGTCTTGGCTGGTTTCTTGTCTTCGCATCCACTGTCCCTTGTCTTCTTGATCGGGTTGTGCTTGTTCCTCAGTGCATTCTCCTGACCGAACAGA
CCGCGTCAACTCTGACAAACAGGATATCCCCCACTCCAAAAGTACCTTGTCGTCGCCAGTACTGATAGCGCTTGGCGTTCCTGGACGCAACCCGACAAGA
CATATCGCAGATTATTCGCTCGTGAAACAATGCGAGTCGCCATCATCATGATATCCACAATGCCAACAGAACCATCGTCAAAGGTGTCGTCCAGCTCGCA
GGCGTTCTTGCGCGTCTTATTGTTACGCTTCGGCGCCATTGTCCGCACGAGAATATTGCGGAATGGCGGCAGCTGCGTGATCCGCACACTTTTCCCTTTC
CATTGCTGCTGGGGAAAGCAGCGACTCGACAACCCGCACGAGTTGAAGCAGCGATCAACATTCTTTTCGAATCAACACTCCTTCTGGCGACCCCAAAAAC
AAAAATGCGATGAGGCGAGATCCGATTTGCCAAAATCTCTTATCCACAGCTATTTTTAGCGAATCCGATCCTGCCAACCCAGCACTTTAGCCGCTCTCAT
TCGCAGTCTGGCTGTCGAGCGAGCAAAGGAAGAAACCAAAGGAAGCACCAAGGCCAGTTCTCTCCCTCGACTCCTCGGCACGATGAAGGTGAACGACGGC
ACGATCACGGTCGAGGTGCAGCAGCACGCGCTGCAGAAGGTGAAGGACCAGCTCGCCAGGGCCGTGGACATCCGCAATGTGCGGGGCGTGGCGCTCTTCT
TCGGGCTTGGTGCGTTCGACTTTAGGGGATCTATTCTCGTCTCCAGTGGTCGCTCATTAGATTTGTATGGACTCATGCAGGTGAGGAGAAGCCGTTCAAC
GTCCCCGGCCGCGAAGTGTTGGCCACGCGCGCTCGCAAGAACGCCGTGTTCTTCAGCGCGAACTACGCCATTTCGGCCGCGCTCGTCGGCGTCGTCACCA
TGTGAGTCGTCTCTACTGTCTCTCACCTCGTTTCTCGCTCGGTATTGACTCGGTCGTGGCGATGACGGTATACAGTCTGCTGAATCCGGTGTTCCTCTTC
GTGCTCATCTGCTTGGCGGGCTTCTGGTTCTATGTCTCGAGCGCCGCTGCAAATGAGACCCCGGAGCAGCCGATGAAGCTGTTCGGCCGGCCCGTGTCTC
CTGACCAGCGCAAGATCGGCATGATCGCTGGTGCGTTGACGAGGAGCCTGCGGTATATTCGATCCGCTGGAGATGGAGCCCGATGCTCACGCACAACTTG
TTCCTGTGGTTACAGTGAGCCTGGGGGTTATTGTCATCTTTGGCGGCTCGATCCTCTTCACCATTTGTTCGGCCAGGTACGAGTTACCGTCGAGACACTG
TCGAGGCATCCTTGTGTGCTCACTTGTTGCCTTGTGTCGTCCTCACGTGCAGCACGGCGCTCGCGATCTCGCACGCCATCCTCCGTGATTGCCCGACGGT
CCGCGACGAGGACGAGCTGGGGTTCCTGTCGCCCGAAGCTGATCAGATCGCCGACAAGGTCTAATACGGCCACGGCACGGCGCCTTGTGGCCTACACCAG
TAGTGGATGGACGCTAGGAGGTCGCCTCTCTCTATACAGATCACACTTTCTCTTCACTTCCCTCCCTTCAATTCAGGTTGTCGTGCCATCGATATCACTG
ACGCCTGCCTGCCAGCCCTGGCATCCCGTTTGACTGCTGGCGCATCCGATTTGCAAGCACGGCACGCAACACAGCATCTTCGAAGTGTCGTCCTGTGCGT
GAAATATCCGCTGTTGCAGTGCAGTCTTGAGGTCGAGCGTTTTGTCCCGCGCAATCGATGGCATGATAATCCTTCCAATTGCAGGCGCATCCGGCTGAAA
GCACCGCATAACAGGGTGACTTGAATTTTGTTCCGCTCATGATTTTACCGCCCTTGCAGTGTTCAAGTGATTTGTCCTGCGTAATCGAAGCCATCCAACT
GCGGGTGCAATCTGTTTGCATGCCTAACACACAACACAGTGATATTAAAGTATCTTTTCGTGCCTGAAATTTCCGCTGCTGCACTGTTCCCTCGAATTCA
AGTGCTTTGTCCTGCGCAACCGAGGCCGTGATAATCCGTCCGATTACTGGTGCATCCAATTTGCAAACCCAGCTCGCAGCATAATGATGTCATTGTGTCC
TTCGTGCCTGAAAGTTCCGCCATCGCAGCGCAATCCCAGGTTCAAGTGCTCGGAGCCGCACAATCAAGCCCTGGATAATCCATCCATCTGACTGCTGGCG
CATCCTATTCGGGGTCTCAGAATGCAGTGATTTCGAATTGACATCTTCACGCGTGATCCTACCTCCGATACTGCAGGTGCTTCAGTTCGAATGCTCTGGC
CCGCGTAATCTCGAGGTTAAGAATTCATCCAACTGCTGGTGCAATAGGTCGAAAGCCCTGCACGCAGCACAATGATATCAAAGTATCGTCTCTCCGTGAA
TCATCTTTCGTTGCAGTTTACTCTCGAATTCAAGTGCTCTGACCCACATAATCGTGGCCATGAGCATCCACCCAGCTGCTGGCGTATCCGATGTGCAAGA
CCAGCACGCAACACAGTGATATCAAAGTGTCATCATTGCGCGAAAATCTTTCGTCGTTGCAGTTTGCTCTCGAGTTCAAGTGCTTCAACCAGCATAATCA
CGACCTTGGATAATCCATTCGAATCTGGCACACCCAGTGGGCCAGCCCGGCACACGACGCAGTGACTCCGAAGTGTCATCTCCGTGCGTAAACCTCCAGC
CATGGCTGATAATTGTCCAGTTTCAAGTGCACCAGCCGGCGCAATCGTCCACCCTCTCTCGCCGCGCGCATCCACACCAGCGAGTCCACATTTTGCGCGA
GCGACGAACGACGAGCGACGGGCGACGAACGACGAGCGAGCGTTCCTCCCCTCGTCCCTGACTTCCGCCCAGCATTCCAAAGTGACGCGCGCTTACATAC
AGGACGTCAGTATAGTGGCACCATCACAACAGGAGTGAACGCCGTGTTGGTCAAAGCGAGCGCGCTCATTCGCTGCCAGCAGAGGGCGTATCTCCCCTTG
TTCACGCTCATCGCCCACTCTACTGGTGTAGTCCGCCGCGCCAGCCAATCCCGGCTTGAGCGCTGGGTCGATCATCGAGAGTGGAGCGCACTGGCTGTTC
TGGTGGTTGAAGTGACGATGCGGCCAATCTGCTGGGGTGTTCAAGTTGCCCAGTTCAGATAGTGTGGGAGCAGACGAGGCGTCGAACGGTCCAATCAGCG
GTGAGAACGATGTCGACTCCGGTCTTCAGAACGTGAGCAGTCATGTTCCGGCGATCTGATTGGCCGATCGATACCGTCCGATCGCTCACCTGAACCCCAG
ATAGCTTCCTGGATTTCAAAAACAGTTGCTCGATCTTGTATCAAGACGGATTTCAACCAATCACCAGACGAGCAAATCCAATGCGCAACCAACGCCACAA
GAATCAGCCGAAGTTGTGAACCGATCGCAGCCGACCGTCGCGAAGTGGTGGACGGCAAAAGCTCACCGCGACCGCGACCCAAATATCCGATCGAAACCCC
TCGCAACGGTTGGGCCGCATGCGCTCGCGACCTCCCCACCCACGGCCACAGCCACGTGTTTCCCGCCCGCTTATCCTCGCTCGCCTCGAGCCAGAAGAAC
TTGCGGCGTTTCATCACAAAAAACGCGAAGCGGCTCAGAAACCAGTGGGCGTATTTTTACTCGCACTTCAGCTCGACGACAGCCAATCAGATCGCGTTGT
GCAGCCTCATCAACGCCAAGGGTCGCAGCACCACCGTTCCTCCCACTGACAAACTGTATGGCGCGCAGGGATACGGGGATGAACCCGATGCGGGTAGGGT
CCGAGTCGCCAAATAGGTGGGCCAAGCGACGTGGACACCATGCCGCCTGGTCGTTATGGGACGACGACGACCGCGACGACCGCATCGCACGGCGCGGGCG
GTTCGCACCCAGGGGCATTTTCGCATTTGCTCCGTGGGCGTCACCTGCTCCTCCGACATCGCCATGTGGGTGTTCGGCTACGGCTCGATTGTGTGGAAGA
CGGGCTTCCAGGCCACGGACACGGTGTTCGGCTACGTGACCGGCTGGCACCGGCGCTTCTGGCAGGGCTCGCCCGACCACCGCGGCTCGCCCGACCGCAA
GGGCCGCGTCGTGACGCTCATCAGCCGCGAGCAGATGAAGCAGTTCGACGATGAGTACGCGGCGCTTGAGAAAGACGACGTGACGTGGGGCCGCCTGTAC
AAGGTGCCGGACGAGCACGTGGCGGACGCGATCGAGAACCTCGACAACCGCGAGCAGTCGGGCTACGACCGCCAGTGGGTTGACGTCCACTGCGAGGACG
GCATGACGCGCCGCGCGGTCGTGTACATCGCGACGCCCGAGAACTCCGACTTCCTCGGGCCGAGCCCGCTGGACGACATGGCCGAGACGATCGCCACTCG
GTGGGGCATGTCCGGTCCGAACTTCGAGTACCTCTTCCGCCTCTGCGACTGCATGCGCCAGCTCAAGGTGCGCGACCAGCACCTGATCGACCTGGAGCGC
GCCGTGCTGCGCTACACGGGGTCGCTGCGCGCCATGGAGTGGAAGGGCGGCTCCCCCGGCTGCGGCATCCAGTAGAGCGAGCGGCCTACGACGATGTCAA
GTCAACTGTCTCCGCCTTGAAAACTATGGGCGATGATGTATTTAGGAGCGCGCCGCCGTTCACCGCGCAGCTCCACGTCAACACTTAGAGAACAACCCGA
TTCAATGTATCATAACTTATTTCGAACACGTCAGTCATCAGTTTGTTGTTTGGAGTTGGCAGTCCAATTATATGCTACAAGATGCTGTCGGTTGGTAATG
AGTGGATGCTGCCTGTGGATGGCCGACTGCCTTGCGATGGCCTCGCACTGGTGGCTCGAGCGCAGAGTCGGATCGAGCAGTACTTTGAGGACTTTGAGCA
GCTCGAGGGGTTCTCGCTGCTCGCGGGCAATCTGCACCGACTGCAGCGCAAGGTGGCGATCGAACTCGAGTGCGTCGTGCGCGATGTACTGGACCTCGTC
GACGAGCGGCGGGAGCGGCAGCATGACTTCGACATGCTTCGAGAAGGCATGAAGCACCAACGCCAAGTGTGCGAGCAAGTCGCACGCGCTTCGATGGAAT
TGATGGAACGAGTCGAGGCGGACAAGGCGAAGCACAGCAGGGAGTTGCAGGAGCTTCACGCGTTCTACGCCGCGAAGCAACAGGTGATGAAAAGGCAGAT
AAAGGCGCGAGCTGAGCGACGACACGACAGGCAACTGCAGGCAGTGCAGGACGAGCTCGATCGCAAGATGGAGCTGCTCGAGCTCGAAGGCGAACAGCGC
CTCGACACCATCAGGAAGCAGCTTGAGCGCAAAAAAAACAATGAGGTCGAGTTCCTGCGAGTCGAGTTGCGACTGCAGGCTCGAAGCCAGGTCGAGCGTG
AGCTGCGCGCAATGATGGAAGATAACAGGCATTTGAAGGTGTCAAGACGATGATATCGACCCGTTCGTTATACACGTGTTGACGCATTTATAAAAGCTTG
ACGGCGCTCGACTGACGGACACGGCACTTTCACAGCGTTCGTACACTCCCGTCGCGTCGTGAGTGGCAGTCAGCGGCTCATGCCGGCGAATGGGTCAATG
TTGATCGACTTGGGCTGGCCAGGCGCCGGCGTGCCGCTCAGCGCCACAGGGTTCATCAGCTGTGAAATGTTGAAGTTGGCTTGGCCCGTGCCGGCCGGCG
CAGGGTAGCCGCCAGTCAACGACGAGCGCGTTGTTTGTCCCGCGAGCTGCGGCTGCATCGGAGCTGCTCCCATTGGCCGCGGAGGTTGCTGGAACTGCTG
AGGCGCATGAGGTTGCTGCTGCTGTTGCAGCTGCACATACTGCTGTCGCTGATTCGCGAACGGGTCGAGGCTCATCCTGCATTCGAACACATCGAAGTGA
GATGACATCACATCGCCGATACTGTGCAGCAGACGTACGGCGCTGCTGTCGGCTTCAGCGGTGCTGATGACGCAAATGGATCGACATAACTGCAACGCAT
CCCATGTGAGTTATCCGACAAGCGACCAGCATGACAACACTTGTCAGAAGAACGTACGGCTGCTGAACCGGCTGAACTTGAGCAGGGGCTTGCGCCTGCT
GAGGCGGTTGGTACGCCGCCTGTCCGTTCGCGTTGGGCGCGTTCGGAGGCTGCGCGGACTTGGACTGACAGGGGAGAACAACAATCAGGATATTGTCAGC
AACGTGGTAGTCTCAACATCAACCTTTGGTTGACACTCACCCCAGCCAACGGATCGAACAGCAACGACTGGGCTGATACGCTCACGCTTGGACCAAAGTC
GTCGATCAGGTTGATCACCGGCTGCTTCTTGGCCGTTGCGCGCTGCTGGTGATGATGCGCCGGCGCAGGGGGTGGAACCGCTCCACCGTTGGCGGCTGCG
AACGACGCCGGAGTCGGTCGTTCAGGCAGCGAAGAGCGCTCGTGGTAGTGGGCGGGGGTCTGCTCCTGTGGGTACTGCTGCGAGTTCCCGCCCCACTGCT
GCTGATGGCCCGACGAACTCCGAGCGCGAGCCTGCTGCGGGTCGCGGTTCCCCGAGAAGCTGCGCGTCCGGTTCCCTGGTGGTGGTCCAGTGAACGACCC
GCGCTGTCCTTGGTCGTACGGCGACGGAGCGCCACTGAATGATCCGCGCTGTCCTTGGTCGTGCTGCGACGGAGCGCCAGTGAACGACCTGCGTTGGCCC
TGGTCGTGCGAGGGAGGGACTGCACCGGCCGGTCCCCACTTGTGCTGCCCATACCCGCCTGCAGACATTCGCGACAAGAGATTAGACACAGGTTTATATC
TTCTCCCCCACTCATATCGAGCGCCGTACCTGAAGGCTGAGCGTTGGGCTGCGCGTACGTGCCGGTCGTGATAGGCTGCTTCTTGCGGCGGTAGACGTCC
CACCGACGGAACGGCACGCGGTCGATCAAGAAGTCTGGAATGGCGTCCACCAAGGTTGAGAGTTAGATATCGTGCTTGCCAGCTCAGCTCTAGTGGTTCA
AGTCGTACCGTATTTGGGAATGTCGAGCGACTCGATGTCGTTGATGCGCACCTCGAACACCGTGTTGAGGCCATCCAGCACCATCGTGTAGTGCCAGTCT
CCAGGTGTAGCCTGCCGTGATCCAATCACGCAACGCAGCACCGTCAGCAACTGCAGCTCAGTTACTAGCGGAAACACTGACTGTGGAAGCCTACCGTCGA
CGAGAAGTGCATCTGCCGGCCGTCATACTCGACCAACTAGCGGTCACACAAAATGTTGAAGCATTGTTAGATGTTTGTTGCAAGATATCGACACTCAAAT
GCAACACACAAACCTTCTTGTAAGACATGATAGAGTGGGTCAGCACCACCTCGTGCACCGTGTCGGACTCGCCGAGCGTGAACCGCCAGCTGATGCGCTT
CTTTGAGGCCGCGACCATCTCGCCGATGTGGGTCTCGTCGCGCAGCACGCGCTTCGGCGGACCGCGCTCCAGAGGGTCCACCTGCGGGTTGTAGATGCGA
CCGGCGTTGCCTCCGTACATGGTTCTTCAGTCACGAGTGTGCGCGTCGGCGGTCGCGTTGGGCAGTGGGAGGCGCGGGCGGCGGTCCTCACGAGGCGTCA
GCTTTTGCGCTACGTTCTCCAGCCCTGATGACTGTGTCCTGTGGTTCTGATTTCTCTCTCTCTGTTTGAGTGGGTTACAGATCGGAATCTGAAAATTACA
CTTCTAGACGGAATCATTCCGAGCAGTACAGCGATCATACACAAATGATACTTTCACTTCAACTTTGACGATACGAACTCAGCACACGGCTTTGTTGGGT
CATGCCAGATGCGATCGAATTTCTCTCTGCAATGCTCTCTCTTTCAACGGTGTTGAACTGTGCAATCTTGACGATTACAGCGACTACCAGCTCGGAAATC
GTTTGCTGCGGCAACTAGGCTTTGCCAGTTCGCGCAGTGGTGGAAATGATCAGACGAAGAAGCAGACGAAGTCACCGCAGGACGAGAGTGGTGATCTGCG
CGATTTGAACATTACTGAAGAATCAATCGCGCGAGGCAACGTGCTCGCCTCACGCTTGGTCCCTGATGGCATACTGGTGATTACAATTCCACGCACCGAC
GCGACATAAAATCTGCCGAGAGAAGCAACCGATTTGGCCACCTATCACACCAGTCCGTCCAGTTCGTGTTTCATGCGATTTCAATTGATTCAGCGGGCTT
AGACGACGTCACTTTTGTTGAATCTCTGCTGTTCGGTAATATCTCGCAGTCAACAAATTCATCATATTGAAAGGTTAAGTTCTGGCGGTGAAAGACTCAA
GCACCTGAACGAAACTATCTCCATCATTTCATCCCAGTCTCAAATGCTTGATTCGCATCGAGTTGAGGTCTACATGACTTATGTATCCCCCACCTAGCTC
TCTATCTTTACGAGAACGATAGTTTTGACCTTCTCGAGTCATTGCAGACAGCAATTCAATGGCAAACCAACCCATGAACAATTTTGGACAAACATTTTTG
GTCAATGCGAAATCATTTTTCAAGTGCACTCCTCACGTGCGACCACCGACTTGCTGTGTACAAGTTCAAAAGGATTAAGCTGTGTTCGACTAAGAGAACG
TCATGCCGAGACCAAGCTGCGCACGCTTGAGATTGTCCTGTAAGGAATACATATTCACACATCAGAAAAGGTGCCAAGTAGTCATAAAAGCCAGTTGATG
ATGATCGTACATGGGCATGCGACTTGAGGATCCACGAGTAGTTGGCCTCGAGACGACCGATGCGCGTCCCCCAGACGAGTCCCATGCCGACCGACACACG
AGTGTCGTCCACGAGGTTCTTCATCCACTTGGTCTCGTTCAGCACGCGGTCCCACGTCGTCACGTTGCCGGCGTTCGCAAAGAACTGGCCACGGAACCCG
AACATCTACATCACCAACACCACCGTCAAGCTCGACCACATCTCTTACCGAACTAGCAGGATCAGCACGTACAGCGAGAAGCGGGAATGGGAAAGGGAAG
CCAACGCTGGCACCGGCTTGGTAGCTCACGTCACCACCGAGCGAATCGCCCGCCGCGACACCGCCATCCATGGGGGAAGCGCGCGGACCGATGCCCTTGT
GGTTGAACCCGCGTACGCTCATGGGACCGCCGAGGAAGAAGCGGTCGCTGATGCGCGCTGGACGGCTGTCGTCCTCGCCGTACGACTTGATAGCTCCCAA
GTGGTACGACAAGCTGAAGTTGAGGATCGGCAGACCGAACACCACGGGTCCGACAGCCGCGTGCTTCTGGCCCGTGAACTCCGTCTTGACGAACCGGACG
TCGCCGAGCAGCCCCGAGACTTCAGTCCTGCATGATCGTGTTTAGAGCCACACTCTAGCAACGCTTGGTCAACCATTGCAGCACGTACGAGTATTGGAAG
AGACCGCCGGTGGTCGGGTAGACAGCGTTGTCGCGCGAGTCGTCCTTGAAGACGTACTTGACGCTCGTCTTGGTCGAAGGCAACGCCTCCGCGAGGATGC
TGGGAGACGCGCGGTACGCCGTCGGCACCTTCGGGTCGCGCCGCGGGATGATGTCGCGCCAGCCGACATTGAGTGACAGGTCGTGCACGCCGGCGTAGTC
ACTGATCGAAATGCTGCCGCCGCGGATCTTCTCGCTGTACGAACTCAGATACTCATGGTTCTGTCAGCAAACAGAGCTGTTAGCCACAAGCTTGTGGAGT
CGATCGAAAATGCGTTCCTCAACGTACGTGCAGCTCGTTCGCGGCGGTGGCGCTCAGGTACAGCGGAAGTCCGAGGAAGCGCGGCTTCTGGAACGTCGCG
CGCTCCGTGTTGCTCCCTGACCGTGCGTACGTCGCAGCCACGCTCAGCTTCTCGGCTTGTCCAAACGCGTTCGACAGCGTGAGCGACGACTCCTGCATTA
CCAACGTGCTCGTCAACATCTCCAATCATTACGAGGACCTGGTGCGCCGTCGTACCGCCGCTTCCTCGTTGCCGTCGGTGGTGGCGCCAACGTGCAGCGA
CCGCCAGCCCTTCTCCTTCACCGTGATGGTCACATCCGTCTCATCCCGGAGACCCGAACTCGCTACACACCACAAAAGAACAACTATCAGCACGAGTCAC
ACACATTTTAAGGGCCGAACAGGACGGTACATTTGTCGAGCTCGATGGAGATCGAGTCAAAGATGTTGAGCGCCTTGAGCTCCTCCGTCGCCACCTCGAG
GTTCCGCACGACCATGCCGATGCGGTCCGCCTCGTACGCATCCTAGCCACCACCCACAGCGCATCATTAGCCTGTAGTTCGGTGTACACATGGCCTGGAT
GGTGCGCAGTTACCTGCAGCTCGTTCTCAAACACCTCGGGTCTGTCAACGGCAGCACGGAGTGTGAACTCATGATTCGCGTCTAGGGACGAAAATAACGG
ATACGGGGAGATTTACTTGGTGCGCTTGTTGCCCTTGATGAACACCTTGCCGATGCGCATGGGCGGCCCCCACGGGTGCGGCGGCGCCGCGGCGCCAGGG
CCGGCGGGCTTGGGAGCAGAGGCGGCCATCGCAGTCTCGAGCTTCGACACCGCACGTGCGAATCACAGCCACACCCACCGTCAGCGATTTATAACGGATA
TTACTGAAATAGTCGATATATGTTGTTATAACGTCGATGCGTGTCAAAAGCGTGGCATTTTTGCGGTGGTGGTTGCCGGCAAGATGGCGGCGCTGTGGAA
GCGGCTGAACCTGATGCTGGCGGGCACGACGCCCGCGCGTCGCTTCCAGGTGTAGCATGGATTTGGCGGAGTGCGGTTCAATGCTAGGGCGATGGTCTGA
CAGGCGGCTGGTGCAGGAGGAGGCCGACGTGGGTGTCGCCGCCGTGCTCATGTGCTTTCGAGGGCTCAAGCTCGAAAACGAGAGCAGGTGAGGAGTAGCT
TCGATACAGATGACGACGTTACAGTATCAGGCTGACTGACCGGTGTTGTTATGTGTTTGTGTGTGTGCAAGTGACACTGGTGATCTCTTTAACGAAGCGG
TGGCCATCATTGAGAAGAAGAAGTTCGACAAGCAGAAGGAGTATGTGCAGGAGCAGACGACCGCACAGGTGGGACGAAACTTGAGCGAGTGGGAACAGTT
TATGAGAGAGACTTGGATGCGAACAATGAACTGGTGTGGTGTGAAGGTCCGCAGCATGTTCGATGCGCTTTTGAACCAACCAGACGACCCGACACAGCAC
CGCTCGAGCATGTCGCTGTCTGGGTTCGACCGGCTGGGCGATGTCAAGGATGTACGAGTGTTCTTCGGATCAATAGACTCCAGATGGATGGTATGGTATT
GACGGTGTTGTGGGTGTAGCAACACTTGCAGGCGTCGTTGGAAGAGTCCCTCGGGTTCTCGCTGCACGTCGAGCCGTCGAGCGTCGAGAACGCGGGCGAA
GGAGTGCACCTGGACGGCAAGGCGGGGATCGGATCCGTTGTGGTGGGTCTTTTTATCAATCGCCAATGGAGCGAAAACTCGGGTGGTTCTGACCATGTGG
ATTGTCATGCGGCTTTAGGCGTTGTTTCCGGGCACGGTCTACCTCCCTGAGCACTTCAAGAAGACCAAGTATCTCAAGGAAATCTCGGATAACCCGTACG
CTCGCGCGCGCTTCGACAGCGTCATCATTGACGCCAAGAACGAGCGTACGTTGATGTTCGCGTCCAAATATTCCCCGTTGGATGATCTAACACATGCATT
CACAGCGTCGACACCTCGGAATCCGTTCGCCGTTGCGCACAAGATCAATCACCCGCCGAGCGCCACGCCGCCCAACGTCATCCCGTTCTCGTTCGACTTT
CCTCCTGAAGGTTTGCGATCCTGTTCATCGATGGATGCGATCGGCGACTCATTTAGCGTCCCATTCGAGCAGAGCCGTTCACGACGGAGGCGTTCCAGGC
GCTGATCCCCAATACTTTCGTCGAGCAGCCGTCTCGCTGGGCCATGTACGGCAAGCGCGCGCTCGTCCATGTGCGTTGATTGCTTGCCACTGTTTTCAAC
CAATTTGTGCTGCCGCGACTGATGGTGTCCACGTTTGATGCTGCGTGTCGTCACAGGGACTCGCGTTCATCGCGACGGCAGACATTGAAGATCAGGAGCT
GTTCTTGAACTACAGGTTGGTTCCGACTTCTCTCGCGAGTATGGTAACGAGCGTAGCTCACCTCTTGAGTGGCGTTCGTGCGCAGGTACAATCCAAACCG
CCAACTGCCCGAGTGGTACACACCGGTCGACATTGACAGCGACCGGGAAATGTGGAAGTAGACCTGTTAAATGGGGCGATATCCCACAGAAACCAAACCA
AAGATTGTCGAGTCCGCGCCAAGAGGTGTCGAGACTGTCTTATATACCGGGCGAGCCGTCCTCAAAACAAGAAGGCCGTCCTCGCTCGCGTTCGCGGCCA
CCAAACTTCCTCCCTCCTACTTGGGGAACTCGGCGTTGTTGGAGAGGATAATGCCCACGATGACGCCGAAGATGCCCAGCGCGCTTGCAAAGATCTCCAC
GATCAGGATCTTGACGTACAGCGAGGCGTCCTGCGCATCCGCGAGCACACAGCTGCTGCCGGCGAGTCCAACCGAGACGCTGCGACAACACCATGAGCGA
TTAGACTAGTTCTCTCTAACCCATCATCCTCACGGAGCACGAGCGTACCCGCTAGCCACGTTGGTGAGGCCGACTGCGATGCCGGCGCCGAACACGGCGT
AGCCGGCAAAGTACAGCGCCACCTCGTTGATGGGCTCGTCGCCGCTGTTGCGCAGCGCCGGCTGGTTCATCTGCAGCCACACGACAATGTTCTACCTTAG
TACCAGTCCTCCGCGATCCACCCACAGCTCCTGCAGCAGCTACCTTGGCCTGCAGGATGATGGCAATGATCACGCCGTAGATGGCCGTGGCTTCACAGAA
AATGATGCTGTTCACAGCCACACTTAGTAATAGTTCACCCGAAGTCGCAATGGCATAGCAACAGACCTGACGAGGTTCTTGGAGCGCACGCGCGGCGCCT
TGACGGACGCTCCCAGCAGGCTCGAGCCAGTCAGGAAGATACCCCTGAATAATATACAATCTTCATTAGCGACCACAAAACGGCAAACAGCAAAGCCCTC
GACCTACCAGGCGGCGCCTACGATCGACAACGCGAGACCAAACGCGACGCCCATGCTCCCCCACGCGTACGGCGAGATGCTGCTGAGCACATCGCCCCAG
CCTGCCTCATTCAAAGCGTCGTTTGCTTTAGCACATTACCCTGCTTTACCGCCGGCCACAGCGGCCCATTACACCAGATCGAGACGAAACACGCACCTTG
GTTGAACAACTCGTCGGTCGCTGTGCTCATGTTGCGTCGCTGGTCGCGTCCCCGGTCGCCGCGAAGATCGAAGAGCCGACAGGCGTCGAGTTGCTTTTAT
GCTATCGAGCGGTGGTTTCCCTGCGAAAAGATCAGGCGGCCAGGAACACCAGAACTGCAAACGACATATTAGTTGGATCATTTGTCATGAACGGTATTGA
CGATAGTACCGTACCTGACGCAACCAGCTACCCATTTGGCAGCACGATACGATCGATCTGGAAAATGGCGACGGTGGACAAGGGCAATCGCCGCAGCCTG
TACGTGGGCGGGCTGGACCGGCAGGTGACAGAGCAGGCGCTCTACTCGGCGTTCGTGCCGTTCGGACCGCTCAAGGCGGTGCAGATCCCGCTGGACTTCA
AGGCGCGTACGTTAGTGTTGACGATGTGGTTGTGCGGCTGGCTTGCCTGCAATACGAGACCTGCCGCTGACGGAGAGCTGACCTGACGCTGTAGAGACCA
GCAAGGGCTTCGGCTTTGTCGAGTTCGAGGACGAGGCTGACGCTCGCGCGGCCATCGACAACATGGACGGTGCGTAACATGACGTTTGGAATGGTACACT
ACTGGAGGTTGATGAATTGCTTGACTCACTTCCTACTGCTTGGTGGCTCTCTGTACTCTCTCTCATTGCGGACGGTCGCTGCAGAATCGGAGCTGTTTGG
ACGGACACTGCGCGTGTCGATGGCCAAGCCGGATCGCCCGAAGCTCGGATCAAAGAAGCCAGGTATGGTGGTCAAACGGTGGTGCATTTGGATGGGATCA
GCTGCTCACCCAGGCTTCTATGTGGTGGCGGCTTCCTGCAGTCTGGGCTCAAGCCGACGAAACAGAGAACGGCACCGACGCAGTCGAATCGGAGGCGCCG
GCGGATGCCTCGAGCTAGACCCGTAACTTGATTGCAGTGAAATGGTGCTGCATCTCTTCGATGCATTTTGGGTTCCAAATCAATTATTCTCAGTCATCGG
AATCGATGGCAGAAGTGTCCACACACATCTACGCGAATCAATTATTTGCTCGCTGCAAGACAAACATGGGGGAAGACGCGAGCCAAGAACCGCCGGCAGC
CTCGCGGCGCTGCGATCTCGGACCCGGATCGCCTTCTCCGAGCTCCACTGGAGCTTCGGCACCTGCGATACCGAGCCTTACATCGCTTGCGACTCGCCGC
GCAGCAGTGCACGCACCCGTCGATGCGCTGCTCACTGTCGCAGAGTTCTTCCCAGCCAACATCCGCCGCGAACTTTTGACAAATTTGCCCGCTGTGCGGT
TGCGAGCACTGGAACTCGCATGGAAGCGCAGCCAAGGCGATACGGTCGATTCTGCCAGTGCTGCAAATGGGGAATCGGCAGGAGACGACCAGGACGCGAA
CGAGTGGCCGTTTGAGCGCGAGAGTCAAGACGAGTGGCGCTCGAGGTGGGTCGCCGCGTCAGTTGGGTCGACGCTGCGCGCCACCGCGAATGGAACAAAC
CGGAAGCGCAACTATCGTCAACTGTTCTGGGAACACCAGTGTCGGATGCTGCTCAAGGCTCGCACGAATGCACTAGACTCGACGAGCGAGAGCCACAACG
ACAGCGAGACAACGACGAGTGATGCTTCTGGGACCATTACCACCATGGGTGACAACCCTCACCTGTTCGCCGGCGTCGTGTTCACGCTCAAGGTCCACGG
TCGCGAGCTCCGCGAAACGAACACGCCGCTCATCCTGTCGCTGTATCGACTGCGCCGTCTCGAGGTTCACCACCCAGAACAGCAGAAGACGAACTGGCCT
TCGCTTCTCCAGCTCGTGGCCGTCCTCCCGAGCCTTCGAGAGCTCGGCTTCTTTCACGGGAAGTTGACAGATGTGCAGCTCGAGCAGATCCGTGGAACAC
TCACAACCACGGGCACCAAGGTCTCGACATTTGAGCTCGTGTCAGTAAAGATCCGACCCAAGGGCTTCCGCGAACTCGTGGCATTAGTGACCGAGTTCGA
AGGTCTGGAGCAGCTTCGACTCACAAACACCATCACCGACATGGACACACAGGCGTTACTAGACGCGGCGTTCCGTGCGTCCAACTTGAATTCGATAGCG
TTGGAGCACAACGACCTCGAGGACGACGCCTTCCAAGGTCTGAGCACCATTCAGCACCCGATAGCGCTGCGTCAACTGCGACTGGGGAACAATGCCCTCA
CGGCACCAACACTCGCCGCGATCTGCAACGCCTCGCTGGACGGCAACCTGTGCTTGGAACGGCTGGAAATCACCAACAACACGGAGATTCGCGACTCCGG
CATTCACGCGCTGACGCCAATGCTAGCCAGCGCCAGCTCTGTCGCTGGACTAGTGCATCTCGACGTGCGCAACTGCGAGTTCGGACTCGAGGGAGTCATG
AACTTGTTGCTCGCGCTGCGGGACAACCGGACCTTGGAGCACTTGAACGTATCGCAGAATTTCTTCGGCACATCGTTCGGCGACATCCTCGCCGACTTTC
TCCTCTCCAACGAGTCGGTCACGACGCTGCAAGCCGACTACGTCGGACTCACAGATCGCGGATGCACCAAGCGACTGTGTTCAGCTCTTCGTCAAAATCG
CGCGCTTGTCTCGCTGTCGCTAGGTGCAAACCGGCTTCGCGACTCGGGTGCAACCACGCTGTTGCGACCGTTGGTCGAGCGAGGCAGTATCAAGCCATTC
GCACTCCTTGATCTCAGTGGGAACCTGCTGACAGTGAGCGGGTTGGAGGAGATGGCGACCATCTTGGAGAGTTCGACGATAGAGCCTGAGAGTCGCGACC
GAAAACGACGACGGCTCGATACCGAGACTGACGCTCACAGGTTCACTACCACATCGCAACAAACCACCGACAAGGTGATTCATGAGCTCAACCTTCTCGA
GAACGACTTTGCTGGCGAGCTCGACTCACCGCTTGCAACGTTGCGGAAGTTTGTAGATTGTGTGCGGACGAGCTCCTGGGCTGGGAAGCGAAACGTCTAC
GATGATGAGGTTTGAGCATAACAATAGAGGGCCAACTCTGGACTACCACAACTCGGCAACAAACTGTCACTATTTGGTTGCCCAACACTGAGCCACGCAA
CACTGGAGCAAAACGCAAAACACACCCTCTTGCAAACCTTTCGTGCCTACAAAAATGAAAGGAGACTCCACCACTCATCAGTTTTTCAAGCCAACAGAAA
GCTCGGCCAACGCTTCCGCTCGCGCGTTCGCCGTGAATCGGTCTTTCGCCAGCTCTCGCTCGCGGTCCTCCTTGCGTTCGATCAGCTCGCGATTCTTGGC
CTCCAGATCCTTGATCCGATCGCCAACGGAGGACATCAATGCCTGCAAGGGTCCGGGTAGGTTGTTGCTGTCCGCGATGTCGTACTCGCCATCTTCGTTG
TCCGACGACATGATCTCGCTGTCCACCTCGTCATCATAAATATCGAGACCGTCGTCGTCTTCATTCTCGTCGTCTTCGTCGTCGGTGTAGTACTTGGTCG
ACATGAAGTGCGTTTTGCTCGTCGCGGAATAGTTGCAGAACGTTTTCCCCTTCGCACCATTGATGGCCGCTCTTTTCCTGACCGTTTTCTCGCAGGATAC
GCAAAAGTTTGCGCGGTTGCCGCCATCGCGTCGTTGATAAGCTGGACCCATCGATCTCGACGATCGACTTCCTCTTGACTCGGAAGTCGAGCTGGATGCA
GTCGCTGAAATTGATAGCATTGCACAATGTTGTTAATAACCAGGTAGGCGGAACCACAGCATCATCAGGTCATTACATGTGTGGTCGAGTGAGTCCAACG
ACTGGTTCTCAATTCCGTCTTCTTTGTTGTTCGTAGTGAAAGACAAAAACCAAGCAGTTAGCATGATTTCGCAATATCCAAGAGTAAACACGAAATGTAC
CAGCAAAGTCTCCATCTTCTTCGCCTGAACAGTTATCCTCCGAATCTATATGAGCAAAATGGAAATGGAATCAGACATCTGGACAAACGCAACCGGCCAG
GTGCAAGATTTACCTCGAGGGAAGTTGTACTTCCCACTGTAAGACTCGTTTGATGCAACGGATCGAACTGAATACGGAGTGGTCTGGGTTTGCGGAGCTA
GTACACATAACAACCGGTCAGTTTATCCCAGCAAGACATCTCACATTCCCCTTGAGCAGGCTTACTGTTTGCTTCGGAGTGCTCAAACTGCGTGTCATCG
TGAGATCCAACCTCCTTTAACACAGCTGTGTGCTCATCGGCAGACTCTGCGTACTGCTTTGCTCGTTCACCTTGTGGGTATGACACCGTGAACGACCTCG
ACTTCTCAAGATTTTGCCGCACTGGACGATAAGGCGAGCTTGGCGAGACAGAACGAACTCCTTCTTTGGCGTTTCGGGAAACCGGCACCCGGGAAATGAT
AGGAATCGGCTGCCCATCCGTCAGAGCGAACTCATGGAACCTGTCCAGGCTTCCATACCCTGCAAGAAAACAAGAGAGTTAATCGATGCACAGATCATAT
TGCCGAAGAATGGATTCGAACACACGTACGCTCTTCGAACGATCGCAGTATTTGGTTCCCCTGGACGAAGACATACTCGATTGCGACATCTGAAGCAGGA
GGACAACACACCACCGGTCAAGTCAGCCTCACTCTCTATGCGAAAGCAAATCAATGCAGATGCGTACCTTTCACCACGGACCCGATGGCGTTGAAGTACT
CGACAAACTGATTCCTCTGATACAGATGGATGTTTCGGGCCATGCAAGCCAACACGGAGCGCGCGAACTCGTCCGTCCACGAGTACTTCCGCGCAACATG
TCTGGCCAGATCAAACTCAGTCTCTTCAGAGGTCGAGCTGGCTAGAAGCACAGGGATGCGTCGAGACGAGCTGTCCCCTGCTCTGCCATCATTTGTGCTG
TGCCGAGTGGGTGGCGCTTGAACACTGGCTGCCATTGTCTTTTGCGGCTTCTTGTCCGAGTCAGCGGACGAACGAACCGACGCGCGGAGCTTGCGTGACG
ACGGGATCACCGGGAAGTTCTTCCTCTTCTTGTGATTCTCCGAGACCACTCGTTTGGCTGCTCAGCATCGTATACAAAGCACATTCAGTAATCCCTTCAT
GGATGCTACGGTTGCTGTTGGAACAGTGAGTGGCTCACCGTAGTTCCTCAAAGCCTGGAACCCTAGAGCATAGGGATCGTCGGGGTCATTCCAATCTGGA
AGAACGAGAGCATCGCCAGACAGACATCAGCGATCGAATTGAGTCCCCAACCAGTCTGCACCTCGCGCCTTACCAGCGTTGAAAATCTTGTTAGCGTTCG
AGTTCACTTCGTAAACGATATCTGGTAGCACTGCGTCAAACACCACCGTGGTTCTTAGCTGAGTTGGATCGAGGATTTCACAGAAATACGAACAAAGTCA
TACTTGCAGCGCGGAAAGTTACCGTCTTCTTGTGAAAACGCTCTTGCATGTCCTGCAGCTTCGTGACGAGTGCGCTGATTGTTCGGCCTGACGGAATCAA
CACATTACACAAACCACTCAGTCACAATGCCACAACACGGTAGATCTAATCGCACGTACGCAACTTCTCGGCGAGCGCATAGACGAGTGACGATGTTCCG
GTTTTTTGGACGTCGAGGGTAATCGAGACGAGAGACTCGACCAGCACGTCCAAATCGTCCGGAGACCACATGCCCTTGTACGCTTTGTTTATAGGTGTGG
TAGCCACAGCAATAGACGGTGGAGGCACGTCGTCAAACAGCTCGGACAGAACTTTGAATCGGACCGCGTTGACATCGTCCAAATCTGTCGAGCACATCAG
GGAACTGTCAATCAGAGACGAGCATCGGGGACGCGCAAGGACACGGTGATCCTACCATCGACTTGGCAGGTCTCCTTGTCTTTCTGATACATTTTCCAGA
GCGCGTAGAACTTGTTCTTGGATTCCTCCACGCTTTTGCCTACACACAACCAACCTCTTCAGTTCGGACACCAGCGCCAATCTACATCAGCTCAATGCAC
TCCACGCCTACCCCAGAGCTGAATGCGCGAAAAGAAAATGTCGGGGACGCGCGGCAGATACTGCTTGTACTGCTTGGCCTTTTTCAGGAAGCGGACGAGC
TCGTCGGGCAACCACACGCCGCCCGTGCGATTCTCGCGCAGCAGCTTGATGGTCTCGTACAGGTACTCATACACGTAGACCTCACCGCCGTCAACTCGCA
GCTCTAAACATCCGATAAAACAGCCAACCGTGAGGCATTCGGGTCAGCGACCACATCGCACGCAGAAAGGTGACTGCTCGTACTTTGTCCACGGAAGTTT
TTGGTGTTGAACGCCAGCGCGAACTGCTTCATCACCTCGCGCACCGCCGCCACGATCTCGTCCTCGCGTCGTCCTGCAGCAGCACATCGCCAGACATAAC
CACGTCAGATCGCCTCGACACTCGAACGGGCTGCGACATAGCGACGCAGCGACGCAGCTTGAAGCGATTGCAACTGCCGCCGATCTTCCAAGATCGAATT
CGCCTTGATGCTTCACCTGGCAACGCGACGTG