Description :
From Genome Similarity Track
Location :
Scaffold_204:6197- 7775
Transcript NameFunction/comments
Phypl_g5226hypothetical protein

Sequence
1578 bases(100 bases per row)
CTGGGAGGTGCTCTTGGGCATTTTGCAGAATGTGGTCGAGTACATCAACAGCAGGTCGGCCTGCTGGGAGAGCGTGACCGTGCTtgctgaaggaggccac
CTGAATGACGACAACTTTACGCCGTGGCTGTCTCTTTGCTGCGGGTTTATTCGTCACCGGACGTCGTACGCCGTTGACGCTCTGAAGCTTCTGCAAGGAC
TGGCTAACAGTGACAACACATACAAGATGAACGCCAGCTCGTGGCTTCAAGTTATGCGGGTGATGCTCACCTACCTGAATGATGACCGTCCACCGGTGGC
GAAGACCGCTTGGGACTGCTTGCGtaactcgctgctgctccccgGAGTGCCGATCGCCAAGGACACGTGGAAGCAGTGTTTCGACGTCATTATCTTTGCG
TTTGACGACCAGGTGAACGACATCACTGTGAGGATGGCGCGCGATGCACCTCTGTACAGTGTCACGCTATTGTCCAAGACATTCCTCCACAACCTGAACG
TGCTGATGGAGTTACCAGACTTCCCGGAGCTGTGGCTGAAGGTGCTCCGTCGTCTGGCCAACAAGCTGGTGGCGTCGAGTTCGCCCACCATGCGATCGCA
GCAGAccagcgtcgtgttcgagacgacgttgcagtcgctgtacaacctgctgctcgtgttgAAGGCCGAGGACGTCCTGGAGCGAGTAAGCACCGATGGC
AGTACTGACACGCTGTTCGAGGAGACGTGCGCGGTTATCGACGCCGTGTGCCCGCAcctgaaggagcagctgggTCTGATGCCTGACGACGTCGCCATCG
AGATCCCCACCAACGGAAGTGAGCAAGGTGGTGAGCAGCCCACTGCCGAGgccaccgacgacgaaggtcAGGTACAGCATACAGCTACCGAGCCGCCCGT
CGAGGCCGAAGGTGAGGCTGAGCAACCCACTGAGCACCAGGCAACCCACAACGAAGAGCCTGAAGCTGCCGTGAATGACACTGAagcggacgaggagacg
ctggccagGCTGATCCCTGAGGAgggtcaagttgaagttgccgaaTCTGTAGACGAACCGGTGAGTCATCACGAATCTTCTCCCGACGCGACCTCGTCGG
AGACTGTCGAAGCTTCTGTGTCCACATCCAATGGTCCTCCCACGTCCAcaacgtccacgacgacacTCGAGACTGTCGTCATCGGCGACGGCACGTTCGG
GatcaaggtggacgaggtgatcgtggacgagatcaccGAGGCCGTATAAACGTTGCATAATGTGTGAAACACACCATTCTATAGAAACTTAAGTTGCACT
TGATGTCCACCACACAAACCTTCTAGGATTTCCCTCATTTCTCGAATTGCGTCCAAAGGTGACGGAAGCCCCGGGAGACGTCGCCTTCGCGGactcgtcc
tgcagcacagAGAGCACCATGGCCAGTGAGACTTCGAGCGTCGACAAGAGCGATCCCGTAGctgtcgttgccgccgcctccgagCCCGCATCTCCCTCTG
TGAGCGCCGCTACGAGCGCTCAaaagaagcccaagaagcccaagaccAAGGTCGTGGcggcagttgctgcagtggccg