Description :
From Genome Similarity Track
Location :
Scaffold_991:6196- 7698
Transcript NameFunction/comments
Phyag_g9022hypothetical protein PHYSODRAFT_495612

Sequence
1502 bases(100 bases per row)
CTCGTTATACAGTTTCAAAACGGGATCTTACAAGTAACTTATCATGGCAGTATCATACCAACAGGTTATCGCGATATGTATTGTATCCCAGTGTAAGGGC
CCAGCACCATTTTTGTGGCATTTGCTGAAAACTCATCCAAACCTCGTGATTACCTGTATTAAAACTCATCCAATGTCGACGTTTGGACGAACTTGTAAGT
TGCAGTTCTGAGCCCTTGCCCTCAATTTGCGGCGAGTTGTTGAACCATGATCTTTTAGACTCGTCCAAATGTCTTCTCTACAACAACGGAGAGAGTCTGT
TCTGAGGACGGCACATGTTGCCATCCTGAAGTTCAACCAGTGCAGTCGAATAGTGTCCGGATGGGTAGCACCTATGGCTTGCACGGAGCAGGGAGCAACT
CCCTGTTAAAGGACTGACATTGTCGGTGACAATTGTCACTGACAATTGCTTTGGTGGCCATCGTGTTGTTGTCTGGTATCTTCATCGACGTATTTTTACC
GAATTTAAACTTCAGTTTGCCGCGTCACAGGAGCTCATCTCCCGTGTGACGAGACTGCGGTACAGCAAACGACGCTGGAGCGAAATACACAGAGTACAGC
TTCGCAATACACGGCAGAATGAACGACACCTTCATTGCACGGCGGGTTACACGGTTTGGAGGGTTCCCTTTCGCCGATACCTGTAAAACGAAGCGGGGTT
TTGCAAGGGTATGTACAAGGTGCTGCAAAGCACCAACAGGGTTGCAGAGTGGCCTTTTTCATCCAAGCAATTCTTCAACTACCAAAACCAGTAATCACTG
GCGCATGTACATGAAGGACGACGTCCAGTGCTGCAAAGCCCCACACCACAACCTGTTGAAGGTCTTCGCCGCCAATCCTGCACCTTATCAACCAGAACGC
AATTCGGCGGTGGCATTTCGAAGTTGCTCACTTTCAATTTCTCCCCGTCTTGCAGACATCAGCACCACGATCGAGCAACACAACCGAGCAATTgaacagc
accacatccCATGCTCTCGTCTAACGGCTCCAAGGGCCCTTTCTTCACGATCGAAGATGCCAAGGCTTCGTTCAacctcttctgctgcgtcctcgGTATC
GGTTCGCTCGGTATGCCCTCCAACTTCGCCCGTGCCGGTCCGATCTACGCGACGCTCGCTCTCGCCTTCATGATGTTCGCCAATACGTATGCTTCCGTGG
TTTTGTCGAAGGCAATGCTGGCAGCTCCGTCCTCGGTCAAGACGTACGGTGATCTTGGCGAGTGGTCTCTCGGCAAATGGgggcgcttcttctccgcccT
CTCGCAGATGGGCGTGTGTGTGATGGTGCCGATCGCTTTCTTGGTTCTAGGAAGCACCCTGCTCGACGTGCTCTTCCCCGACACGTTCAGTCAGACTTTC
TGGATCATCTTCATGGCGTTGCTGGTTATCCCCGTGTGCCTTATCCCGACGCTCAAGGAGAGTGCCGGCATGGCCTTTGCCGGTTGCATGGGTACGGCCA
TT