Description :
From Genome Similarity Track
Location :
Scaffold_333:61951- 65744
Sequence
3793 bases(100 bases per row)
CAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAA
GGCACTTGCGTGTCACTGTGCAAATTGGAGTCTGTACTGATACTTAAGCCTATACCTGCCTGGATTTCTATCTTCTATGTCGTTTACCTGTTAAATCCCT
TGCCAGGCTCGGCTGCATGTCCTTTCTTTCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGGCGTAATCAATATGGTCACCC
TATTATGGGTACACTCATCCGAATCCAGGTCGCTTGGATCCACTTCACTGTAGGGGTACACTCGTCATGGATCTGAGCTCTCCAATCATCCAACATCGTC
TTGCGACCGTCTGTGATCTCCATTGTCCCACGAAAGTGCGAGATCCACTGCATCCATAATCCCTGTATCCCGGATCCAGGTCCCTCTATGCGGGATCCTC
ACCCCTTTGGATCCGGACTCGGAAGTATGGGATCTGGGACACCTCGCGGTGGATCCTAACTTCTCGTTAGCTGCGGCTGCTAGATCCACCATCGGATGGC
ACCTACCATCATTCCTTCATAGGATCCACACTCGATCCACTGGTACATAGCATATCCCATATCCACCTAAGTGAATCCCGATAAGGGTGGATCCGAGATA
GGTCTTGGTGGATCTTGCCTTCGCGTACATCACTCATACCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGTCATGGCTAATCCACCACAGGCAACT
TGCATCCGTGCCAGACAATCTAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGTCCATTCTCTTATTTCTGAAA
AAGCACTTCACCACAATCGCCTCCTGTACGTTGTCGGCGCTGCACAACAGCGTTCACGGCGTGCATTACCAGCATCCACAACCGCTTTCTCCCCTTCGCG
ACACATGTCTCCCGCCAAGCGTACCGGCAAATCGTCGGGCAAGGCCCCATCCACAACCCCTCCGGTCAGTCCGTCTTCTATGTCGCCCACCGATCTGCGG
GTTCTAGCCCAGGCTCTTTCCGATCAGGTGCAAACCTTGACGGCGGAGCTCAAGACGGCCCAAGATGTTAGCGACCAAGCTGCGTCTTCTGCTTATCGGC
CCAACTCCAAACCTTGCGAGCCACAGGTCCATGACCAGGCTATGGAGATCCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGTTGCTGCAAGTTCTTCTTGGGTGTTATCAGTAAAGTGTTTT
ATTCACGGTTATGGCTTGTTGTCTGTCTATCCCGAGCAGAAGTTCCGTATAATTGAGAACAATGCCATTTTCCGTTTTAGGAGGATTGGTAGTCGAATCT
TCCAACACTGAAATCGTAACTATTCTCTCATATCCATGATATTCAGCGGTAATCGTTGCCTCCCCTTTGGCAAGGGCAGTAACTTTGCCTCCTTCACTAA
CACTGGCGATTTAACTCGTCACTGCCAGGGATGCTCCCCGTGGCTCCGTTTGGTCCGGATGCCGCTTTCATTCCTGGTGGACGTGCTCCCGTGGCCTTCG
CTACCAGAGACATCGAGCCTTGGTCAGCCAAGAAATTGAACCGAGTCGCGGTCATCTCCATGAAGATCACGGTCCTGTTTCCGGAGTTGCCTTTTCGGGC
TGAGTGGATATTCCCTCGGACAGCGGACGCCATCTTGAGGGCCGGGTACGTGGATTCACTCATCACTAGACCTCTCGTGGAAGAACTGACAAGTGCTGCC
CCGTGGGATACGCTGGTCACCACACCGGTGGATCCGGTTAGCTTCAGGGGTGATGTGCGTGGGCGACTCGGGGTATTTGTTCGGGCGTTCCGGGATTTCG
CCTCCAAGCACCGAGTTGCTATATGGGAGGGCACTCACCGGTTCCCCATCTCTCGGAATCAACTGCAGGGTTCGACTTGGTTGTCCAACTTCAACAAGCA
GCGTGGTAACCGACGTAGCCATGCGGGCCGAGCTTGGAAAAGAGTCCTTGTGATCCTCGTGTTAGCAATCCAGGACGGTTGGTGTGACGTGTATATTTTG
CTGGATCCATCCTTCTTGCATCTTCCCCGACGCGGGGATAAGGTGGCTTGGCTTCCGGGATTCGCATCCCGTCAAGCCAACTTGGAGGATCCCAACCTCC
ATCGCCCAGAACCCACGAGCCTATTGGAAGCCTTGCGAGAGATCGACGAAGCCGAGCCTTGGCGTATCCAGTTTCGCGGGGACTTGAGCCAGCACCCAGG
ACGCCAGATCCAGCGTCTAGTGGGCAAGTTCTTCAACGTTCAGCCCAAGACTACCTGATCCTCATCACTCTTTTGACGCCACGCCCCCAGTTTCAGTCTT
CGTGGATTCATTTCGTAGCAGTAACTAGCGACTGGAAACTGGGTCGAGCTAGCCCTTTGCATAAGCTATTATAATCCACACTCTCTTACTTGAATATGTC
TATAACATTCCCTCGTTGGTTGAGAAATCTAGTCCGGGCCTTTCAGTGTACACCTGGATCCGGGCGGGATCCACCCTTTCAGTGTACACCTGGATCTGGG
CGGGATCCACCCTTTCAGTGTACACCTGGATCTGGGCGGGATCCACCCTTTCAGTGTACACCTGGATCTGGGCGGGATCCACCCTTTCCGTGTACACCTG
GATCTGGGCGGGATCCACCCTTTCAGCGTACACCTGGATCTGGGCGGGATCCCGGATCCGGTTGGATCTGCGCCTGGATTTCATCCGGATCTAGCGCCAA
TGACCCAGGATCAATTGGGTCAGTATAATTGGGGCCCTTGAAAGCTCGTGCTTGAGATCAAACAGGACTCCTCGCACGTAAAACGTCACACTTATGCATA
AACATTCCCTCCTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTTTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTTCTCCTCCTGG
CCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGAGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACG
CCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGTCTCGTCTACCCAACTGGGTTCGTCATATCCAC
GCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGTTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAT
ATCCACATTCCAACTATCCTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCT
TTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTTACCGCGTGTTCTCCAATCTTCTCGCTCA
CCCGGAACGGTCCATGCCATAGATGGGCCAGTTTGCGGGCGTACCCTTGCGGCCTGTGAAGCTTATATTAATAATATTAATACTATTAATATCGTCTTTA
CTTTGAAAAGTGACATCTTACAAAATACTGGTCTGTGAAGTCTACATAAATAATATTACATATCTCTATTTGAGAAGTGTGCAGACCTCTTAG