Description :
From Genome Similarity Track
Location :
Scaffold_36:619490- 620587
Sequence
1097 bases(100 bases per row)
AGCACTATCACATTAAAGAGATCGTTTAACCGTTGAAACAACGGGTTCAAACGCGCGAAATTGCTATCAAACATTTATATTCAGCTACTATCTCCGACAG
GTATCACTTTTAGAGTGTTAAATTGATGGGTAGGCCAGCAAATAATTCACAAACCCATCTCCGGACCCAGCCCATCCCAATGACTGGCAGCGAGCTCCAG
CTCCCCTTTGTTTTGGCCTGCCGCCTTTCGAAATGCAGCTTCAGTTGCCATTTTTTCCTGCTACTACATGTACTCAAGAAAGTTCAATGCATCCTCTTCC
CTGCCGCTGGTCACGCTACTATACGGCGGTGGGTCCATCTCATACCCACGTTATCAGAATTTTAGCGACCGCTTTCTACACAGCACCAGGTAAATTGCAC
GTAATGAACGTGTAGCTCTATTGATTACAGGCCTGACCTTGCTCCTTTCGTCTGTATCTGTTGCTCTACATCGGCAGTGAGAGCGTAGACCACGACATAC
GCGCCCATTATCTTTGCTCGCTACAGCAGAAGAAGGACGAGGCTGCACTTTTTACGAATGACCAACGTTATCAGACGTACCGGCAGGAGTGCACATGCTG
TGCCCCGTCGTCCTGGCTGGACGCGCCGACATGTCCGCTGCCGTCTTCAGCGAATCACGGTACATGTACGTACGAGTGATACGGTACGACGGATGTTGTG
ACTAAGTTTGTGTACAACCAACACAAATCTGCTCATATTGCTTGCTACTTTCGATGATCGTATGCTCGGTGACCTTAAGTTGAAGTGGCCTCTCAGCGGA
CATCCCACCACAAATGGCAATCCATCGACAAATCCACTTTTAGTGTGTGGAAGCGTCACGCTAAAGGCGACGGAGCGGCGACATGTACGCTCGCCGCTGG
GCCTACCTGTCGATTTGCCTACCGCGACAGCGACTACACCTGCTAAAGTGCCAAGCTACGCGAGCTAAGCGAGCTTGCAGATGCAAGTTGCATCATGCCG
ATAGGTGCTGGCGCTTACTAACGCTCAACTGCAACGGCAATTGGCCCCGGATGCACTGAAGCCTATGAAGTCAGTGAAAACGCGTCATGCCCGCTGC