Description :
From Genome Similarity Track
Location :
Scaffold_2:61947- 65930
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_2-abinit-gene-0.135Ankyrin repeat protein
Pytir_DAOMBR486maker-pir_contig_2-fgenesh-gene-0.33Whole genome shotgun sequence assembly, scaffold_129, strain Mel28

Sequence
3983 bases(100 bases per row)
GAACAGTCACATACATGATCACAAAATGCGCCTCCGCTTTGTGCTTGGTATGTACGTGCACCAGAGATATGCCCCCCACACTTACACGCCAGGCTACCTG
CCATCGTCTGATTACATTGTACGCAACCATTAGGGAACCTGTTCAGCGCCGTGTCCGTGCTGCTGCTACTCGTGGCGTGCAGCGAGCCCAAATGGGCGTA
CGACACCGTCAACTCGGTCGACATTGGGCTCTGGTACCTCGCTGTACGTCCTGCACTCGTGAATCCCCTTGCGCATTCGTCGGGAGTATGACCGCTGAGT
GTGTTTGTTTGCTTCTTTTATCACGGAAATCGTCTCTTGATTATTGATGCGACGTTGGCAGGGAACTGGTGTGCAGTACAAGATGATCAACGCGGGACTG
GCGATAGAGAGCGATACGGTCTCAACGAGCCAGCAGGTGTTCACAGTCTACAGTCGCTTCTGGTAGAATCCTGATACGAGCTGTAAGTATCCACTATGTA
GCCATGCTATCTAACCACCCGTTTTTTGCTGTTTCCGTATGTGCGCTGTCTGTCAGCGCTATCCCGACGATCGCGGTGCAAGATCCGTGGTGCCAGGGAC
TCGCGACCGCAACCAGAGGACTCACGGTACTGGCGCTCATAGCGGCGATCACAAGCTTCATTTTCAGTTACATGGCGGCGATGGACATCAAGACGCCGAC
GTGGGACGGTGAGGGCAAAGTGACCACGCTCGTCAACTCGGCGGTCTGCTCGCTGTGTCAAGTGGTGCTCATGATCCTCGCTGTGGTCTCCTGGCAGCGC
ATGATCTGGAAGAACGACGCACGGTGCCGCGCGACCATGAAGATCGACAACTTTGCGTGTGTGTCATCGGCTTCCTCCCACTTGCTCGCTATTGTCGACA
TCCCATTTGCGTTCACGACATACTTGCTCTGGCGGTTGTCGCACTCGTACTATGTGAGTGAGTGAGCGAGCGAGAGATGATGCTCTGTGAAAGCTGCCCT
TTCGAAGGATTATGCTGAGTGGACATGCGGATTTTGGATACGTACAGGTGGCGAGGAAGAATGGACAAATCGCTGACGGCTTCACGCTCGCTGCGAAGAA
GGGTACTGCTGCTGCAATAGTATCGGTCTTCCCAGTCACCTCACTCTTGCTACGCACCGCCTCATCGTTATTTACATTCGTTGTTCCGATAGATAATGTG
GACGAAATCCTATCGGGCATCGCCAACAAGATCGACATCGACGCGATCGGGTCAGATGGACGCAACGCGCTTCACTGGGCGTGCACTTTGAATCGAACGA
GCATCTGCCACGTGCTGCTGAAGAAAGGCGCATCATTGAGCAAGAAGGACGTGCGATTGTTTGTAGTTTGCCCTGCTTGTAGTTGCAGCCTATGCGCATT
TGCTGTTGGTCCTCAGTTATATTAATGTGTGCATTTGCAGCGAGACGGCTGGACCCCTCTTCATTGGGCGAGTCGAGTGGCAAGCTTGGACATCGTGCGC
TTGCTGGCAAAGTACGGAGCGGATCTGAACGTGCAGGACCGGTGGGGGACAACGCCGTTAATGCTCACAGTCGTGGGCGAAAACAAAGTGGCGGCGTCAA
CGCTTATTGAACTTGGAGCAGATGTGAATTCGCGAAACGTAAGAGCGTGCGTGGCTGCGAATTATAAAACAACTGGTCCCCATGTTGGTACTGACTCTGA
AAATGGTGATATGGTGGGCTCTGTGAGAAGGTGTTTGGGCAGACAGCGCTGATGCTGTGTGTCGAAGCGGGCAAGCACCTCGTTCAGCTCGGCATGGTGT
TCCTAAACGCTGGTGCGAACCTGCGGCTCCAGGACGCGCAGGGTATGACAGCTTTGCATTACGCGGCTTCCACGGGCAGCCTCAACATCCTGTTCAACAT
GCTCCAGCTGTGCGACACCGACCTCGTCGAGAAGCCCAACAAGGTTCACTTTCAATTATGAATGGTATGCGTGTTTTGGTTGGGAGTGCTCACTATGCTT
ACCTTCTGCTGCAGTTTGGAGAAACGATCTCGCAACTCGCTGTGCTCCGAAATCACCCGATGGTGCTAGATCTGATCGAGAACTGGCGAAATGGGAACCC
AGTCTCACTGGCCGGTGGGAGGGACAGTAGTGCTAGCGATGACGACGATGATACAGATGAAAGCGACGACAGTAGCGACAGCAGCAGTGATGACGATGAA
GCAAAGAGCGATTGAATGCATGGCGATGCGAGATTGAGACGCCAAGAAGAAAACACCCAGACGAAAAACAAAAGAAAATGAAAGCTAGATGTCTATAAAA
AAGGTTTTACACTCATTCACTCTACTTGGAGAGATTTTCGAGAAGCAATTTCGTGCCAGTCTGCGACTCCGTGAGCGCCTTCAAGCCCGATAGCGACGAC
TTGAGCGCCTTGGCCACAACCTTCTTGGCGTCCTTCGCGCCGTGCTCGGACTCGAGGAACGCGAGCACAACGAACGAGCCGCGGTTCGAGAACGCCCAGG
TCGACACGCTGTCCTTCGCGGCATCTAACAGAGGAATTGAGAATGCCGTCTCCTTGATCGCACGGCGCAAGGCCAAGTGCGCGATAGCGTCCGAGAAGAT
TGGCTCCTGGCCTTCTTCTGCTGGCTCCGCCAACACGGCGTCGATCAGGCTGGCCTGAATGTCTTCGCTGGAGCTGCGCTTGAGCACTTCCACGACCACA
TCGCGTCCTTCCTTGGATCGAATCAGCTCGTTCATATTGGCAGCGACCACCTCTTCCAGCTTTGGTAGCAAGCCCTTCAAGAGCTCTTCACGACGCGACT
CAGGGTCCTTCTTGTAGTTTACAACCATCTGCGTGGCGTCCTCTGGCGATGGCACCATTGGCGGCGCGAGAAGCTCAATGTCGTCTGGGGACAGGTACTT
CTTGTTCAATGGGCTAAAGAGCTGCAAGAGAACCTTGCGGCCAGTTGGGTGCAGCGCAACCGCAAGCAGGTGGTCGTTCAGTTCCGCGAGGATCGACTTT
TGCACCAAGACGGTATCATCGACCACATCGAGGATGCGCATGATCACCAAGTAACCACTTGGGTGGTTGCATGCTTCGAGCACCTTGTCCTTGAGGCACT
TAATGATGCGCTTCTTGTCCTTGGGTGAGCCCAGCGAAATGCACTTGTTCACGACACGCGCACCGTTGCGGGTCGCCAGCAGCGCCAGCGACGCGTCGCG
GACGTTCGCGACCATCTGCATCACATCGTCGTGCTCGGCGTGGCACAGATACTCCCAGAGCAGCGTCTGCACGAAGGCCAAACCCAGCAACTGCTTGTCG
ACCATGCGGTTCAGGATCGTGGCCAAGTGCTTGAGCACCTCGTCCTTCTTCTGTGGGTTCGCTTCCAAGATGTCCGCGAGGTTCTTCTTGTTCTCGGCCT
TGAAGTACGCAAACTCCTTGCCGTAGAACTCGAGCTTCAAGCCAGAGAGCTGCGCCGGCTTCAAGTGCTCCTGCGCATACTCCAACACGTTCGCAGCAAT
GTTGTGCGTGCCGATCTGCACCGCTTGACCTGTAATCTGCTTCACAATCGCGGCACGGTCCGCAACGCTGCCGTATTTGATCATCTTCTGCACGAGGAAG
CAGCCGTACTGCATCTTCGCCAAGTCGATAATGTGCTCCTTCAGCTCCGCCACAGTCTGCGTGCGATGCTCTGGCTTGCCGTACTTGAGCAGCGCCTGGA
TCACACGCGAGGCGTCGTGCTTCGCAGCGACATCGTAGATCTTGCCCTTGACCAACTCGAAGAGCTCCTTGACCAGCGCTTCACGCTTGCTCTTCTCAAC
GTCGCGCTCGCGAATGATGTTCCAGATCTGCTTGGCGCGCGTGACCATCTCGTAGTGAGGGCGCTGCATCTTGCGCTGCTTCTTGGCGACCTTCTGGTCC
ATGAACGACTTCTTGGCGTCCGCATCGGACGCAGGGCGCTTCTTCGCGTTGTAGCCGCCATCCTTGTTGTGGAACTTGTTACC