Description :
From Genome Similarity Track
Location :
Scaffold_6:61946- 64355
Transcript NameFunction/comments
Albla_Nc14009220ATPbinding Cassette (ABC) Superfamily putative
Albla_Nc14009230
Albla_Nc14009240

Sequence
2409 bases(100 bases per row)
AATCTACGCAAACACCAGTTCTCTAAAGATTTCTGGTCGAGTATTGTGCAGATTTATATCGAGTCGGCCATGTACATCTTCACTTCGATTATGATGGCTT
CACTGGCGATGAAAGTGTGGCGAGGCGATTTAAGCCCCGGCCAGTTTTTTGGTTTTGTGACCTTATTGAGTCGAGTGTCCACACCGGTAACTATCCTGGG
TGGCTTCATGCGTGTGGCGATTGGGAACGCAAGTAGCCTACAGCGAATTGATGATATCATTCTCGGGCTCAGTCAGCATGAGGATGATCCAAGTCATGAA
TGTAATCTTCCATCCCTACCAACGATGAAATACGAGCTGCATGTCGAAGGGCTGGTATTCAAGTACGATAAAAATTCCGAAAAGTGTATTTTACGAGAAC
TAACGGCGACATTCCCTCGAGGAGCATACATCTGCATAGTTGGACCTTCAGGCTGTGGCAAAAGCACATTACTTGCTTGTCTGATGCAATTCATTGAGGC
TGATGGAGGATGCATTTGCCTGGATGGTAATGATATTTACAACTACTCCAAGAAATCATTTATGGATCAGACTGCGGTTGTCTTCCAAGATGGAGGTATT
TTGAATGGCACCATTTACGATAATATTCGATACGGGAACGTTTCCGCTACGAATGAAGAATGTGAGGAAGCTGCACGGTGTGCAGAATGTCATTTTATCC
GGGAACTGAAACATGGGTTCAATACCGTTGTGGGTCAGCATGCAACCTGCAGCTTAAGTGGAGGCCAGGCTCAACGTATTTGTCTTGCTCGAGCGTTGTG
TCGGAACCCTCAGATTTTGCTTTTAGACGAAGCAACAAGCGCGTTAGACCCCGAGACAGAAGCATCCATTGTCTCAACGCTCGAGTCACTTGCTCGAAAC
ATGAGTATGACTATAATTTCTGTAACACATCGTCTTGCTACCACCATGAACGCCGATCGGATACTAGTGCTGAATGCTGGAAAAGTGGCGGAAGAAGGCA
ATTACGACCAGCTTATCCAGCGCGGAGGATTATTTTCGGAAATGACGCTCAAGGTTGATCACACCAATGATTTTGAGGCACCAATTGCAACTCGGACACA
TTCTATCAGCCCCAGTTCACGCATTCTTCGACCTCAAGTGCGTCAGGATGTGGAAAAGGTGGAAGATACAGCTATACAAGGCGATAGTCAATTGGCGCTG
CAGCAATTCACACAAAATTTGAGTGCTCGAGCAAACGACTGTGCAGGTTCGAGACAAATCACAAACCCAGGGTGGTACCGCTATGGGAATCGAGCCTCAT
ATTGTCGTCGGACGAGTCATTACACTGATCATGGTTTCCGTCGGTCCACTGGAGCCTCAAGCGATCGTCTTTCAAACACATCGCAGCCGCCCGACATTTT
GGTTCATCGCAGCCTGCTTCCTCAGCATCCGGCGAGTGTGGAAATTGAGAACGTGGATGAATGTACGCCATAGTTCGATAAAAGCACCATACCAACTTTA
GGATGTCGATTGTGGAGTTTTGGCAGTGTGCAGACTGCCTTTTGATCCCTCCAATTAGTTTTTGCTTGTTATTTAATGCTTAAGCCTCGATTTGTGTTTG
TTTTTTTGCGGGCCGAGTCTGCCCGAGTTTTGATCGCTTTATTAGACAATCATCTTGATGAAGGTCTCCAACCCATTTTATCAAATTCATGGATCGATTT
AAACCAATAGGTAAGCTTGGCTTATAAGCTGGAGGATAATCTGTGGGTTTTTTGCCTGAGTACTGTCTGTAATGCGCTTCTATTTCATACAGTATGCATT
GTAACATTTGTTTTATGTGAATTGTCCGCTTCCATAACTGAAAGAATGGATGAGTGAGCGTCCTGTGAACCAAAGCATCACTTTTTTAACGATCAGTGTA
TTGTAATGCATATCGTGGCCCACCTTTTAGCTACAATATAGTTTGAATTGTACGTACGATTCTATATTCTAAAAATTGGAGGCGTGATTCTGTGAGTCAA
AGCAATCAGTTTGTCAAGATAATGCATTTCACGGCCCAATTCTGAACCTCAACTTTATGTGAATTGTGCGCTTCCATGGTAAAAAGAGTGGAAGAGTAAG
AGTTCTGTGAAGTCAAAGCAATCAGTTTCTTAACTTTTCAAGGCAACGCATGTCGCACTCCAGCTTTAAACCTCGATTTTATTTGAATTGTGCGCTTCTA
TAAAGAATGTACAGTAAACAATTAGAAAATTCTATGGAATAAAAGTTGCCATGCTATCAGTTTTCGAGGGAATCAATTCATGGGTAGGTATTGCCCATCT
CATTGCCTCAATTGTATGCTGAAGATTAGATCATAACTCAATATCTGAACGGAAAAGATGATTGTTCGACTCCTGTTAACGTATGCTATTCTCAAACTGG
ACGCTACGA