Description :
From Genome Similarity Track
Location :
Scaffold_5:6194- 9057
Transcript NameFunction/comments
Physo_128504hypothetical protein
Physo_128505hypothetical protein

Sequence
2863 bases(100 bases per row)
CCATGGCGATATGGTGTTCAACATGGGAATCGAGAAAAGCGTCTAAGCGTTCAATATCCCACTCGCACAGGCGCTGTCGACGCTTTATCATAGTCAGCGT
TAACTACACAGAGGTCAATGGCACGTTAGCGTTGGGAGTACACCTGGCACCACAGAACGCGTGAAATACCTTCGAGGCTTTCAGGGACGCTTGCAACCAC
GCGTAGATGTGACTCGAGTCTTCGTCATTCTGAAACTGCGCATACATCTCGTAGAGCTGAAGGGCGGCTAGAAATGCGTCTACATGGTTGGTAGACCTGA
ATCTAGGCTCGTAAACCTGTTGCATAATAACATTTGTTAGACTACGCCACAGAACTCAAGTAATTCGCATACCCACCCAGTCGCGTGAAGGTTTGCGTAC
TGGCTGGAGGGTGTGAAAGTCAAGGAACCCCTGGTGCCATTGAAATCTCTCCAACGTCTAGGCACACATCGGAATTGAGCCATCGTGACGCCCACTGAAA
CACCAAAGAAACGTGCACGTACCTCTCCTACAGACATCGGCTTGCCATAAATTTTCTTGTTGTTTGATGCTGTTCGGTTGACATCCGGCGTGAAAGCCTG
TTGTATGCAAGCAGGACGGTTAGATATCAAATAGCCACCACAAGTAGGACATACATGCGCACCGGGACAGCCTCGTAGGTGTAGTTAGGGCCCGAGAGAA
CAAAGTAGGAGGAGCGGTCTAAGTCGGTATCTTGATCGCTGAGCTGCCCTTGGCTCTCGGAGCGCCCTCGTGCTGTGAGCTCCTGTAGGTTCGAGCGTTC
TTCGTCATCGCTGCTGCTGCCACCCACAGTGCTGCTGCTGTCGGCCGCCCTGCCGTCGGTGTACATACTTGCGTCGGCCATGATCTTCTCGGAGAAATCT
CCCCCCACACGATGTGTACTGTACCACTGAGGAGCGACCGCGACTTTTGACAGGTTCATTTTGACTGTCGCTCAATTCTATGGAATGCCTTTATTTTATT
TTATACTAGATCCTTACACTAAAAGACATACTCACTGCATCCGCCTGCAAAGGCTGCTGTTGCAGTGAGAGCCTGTTTTGGCAGCACCATTGGGTATTAT
AGCCCTCATCGCTGACGTCACCGCCTTAGCCACCACCATTTTGGTCCTCGGCGATCCGCCTGCTTTTAGGCGCGCTCCGCACTCTGATTCGAGATCACAC
GATGGACTGCTTGATCGTCCGGCCTCGTCCTGCAGCGTCTTGTGATGGTTGATGCCATCGTTTAGCTTGAACACGCGCTTCTTCTCCTTCATTTAGGGCG
CCTCACGCGAACGTTTGTCCGTGTGGGCTGACGTATGACCGCAGCCCAACAGAGCGGCTCTGAGAGCCGCCCCAGTTGTATCGATAGGCCTTGGGCGACA
GCGCGTAGTATTTGCCTGGGTGCTGATGGGCTCGTAGTCGAAGCCCCCTGCTGCGGCGTCGGGCCTAGTGCCGGGCCTGCATGCTGTTCGGGTTCACGTG
CTGCTGGAGTTCATGTACGCCGGGCCATTGAAGCCGCCGCTATTGGTGCCGTGGTCCAGGGATTTGTAGTAGAGCTTGGGAAGTTCGCCGCTGCGCTGGT
GGTGCGGCGAGTGCGCCTGGTACTGCGAGTAGCCATAGCCCTGCATGGCGAAGAGGAAGGAGGAAGTCAGGCGGGTGTACTGCCGATGGAATGGGGGGGC
TTGTGCCGCCAGCGCTTGCCTCGCCTGCAGTCGAGAAACACGTCAGCAATGGGGCAACAGGTTGGCTAGAGTGAGCAGCGTACCGAGATTGAGTTGTTCT
GCTTTCGGTTGTGCCTCGTACGTCTCGTCGTTGCAGTAGAAGGCGTCCATCATGTGCCGTGCCGTGCTTGCCCTGGGATAGTGTCACAGCGATTGCCGAG
CACGTCCATCAACCGCGATATTCACAATTCACTCACTTAGCGAATGTTCGCATTATCCTGCGAATTACGCCAAGGTTTTTTCAATCGAAATCTCGACAGA
GCTTAATATTACGGCCGTATCCAAGCTTTGATTGGATAACTCTGACCGATGAGATTGACAGCCGGTGGAACCCGAAGAGTCGGGGCAGGCCGCTGGGGAC
CTCGCTTACCCTATCCCACCAGTATACAAATTTCTATATTAATCTTATCCGTGCAAAATCGGGATAAGAGCGGTCGCCGGTGGGTTATACCTGATGACTC
GGTCGTGCTCGCCGCGTTTCTTTGCGAACACCCAGCGACAACCGATCGGTCGAGCACTCGGTGTCCGACGGACCAGCGTTCATGACCCGTTGTCCGCGTG
TGCCTTGAGCTCCGCATTCATTGCCTTCACCCACTCCCACGACTCGTCGCTCTGCATGGCCTGCTGATACGTGATGGGTGCGTCGTTGGCATCGCCGACG
TCTGCGGCATAAGCCAACACGGCCTCAGCCAATAGGCTGTCTTCGTCCACCCTTGGTCGCTTCGGAGACGGCGGCCAGAAGTGCTCATCGTCCTCCGAGT
CATCTGGACCATCTTCTTTCGACTCCTCGCCGTCTGCTAAACCATCTCCAAGTAGTAATACCGGTTCTCGGGCGCGGCGGACCCATTCCGACTCGGGGTG
GAAGACCATGTCATCATTCAATACCGGTCTCGCGAGTCGTCGGTACGTTGTCAGCTCCTGCATGGATCGCTCCGACGTCTCCACCTCATGCGTCTCCGTG
TCCTCGACGGTCTCTTCCACCGATTCCATCGGCTCGTCGGCGGCAGGTCGTTGTATCTCCTCGGGCAGTGCCGAATCCTCGACATCTTCCGTCAACTCAA
TGATCGGCGAGTTCTCGATCGGCGCCATGCCGTAGATGCCGTTCACCTCGCGCTCGTCCAGTG