Description :
From Genome Similarity Track
Location :
scaffold_19:619288- 625861
Transcript NameFunction/comments
Plaha_PHALS_09698hypothetical protein F443_14156
Plaha_PHALS_09699hypothetical protein
Plaha_PHALS_09700transmembrane 9 superfamily member 4-like

Sequence
6573 bases(100 bases per row)
ATGAATTTTTGTAGTGGTCACATGCTCCTTTGCGCGGCAGTGGCTGTCCAAGGACGAATGAGTCTACAATCTGTTGATCTTTCTTCTTTGTACTTTTCCC
TACTTTCGCAGATAAGGCATTAGGTAAATGACTGCGTTTTTTGCGACTTGATCCTTCTATATGGCGAGCCAGAAAGCGCTTGACGAACACAGCAAGTTTA
ATGTGGCAGGAATAGCATGTGTGTTCTGATCGTTGCCTCGGCTTAAGTCTCTCTACTAACGCTTCGCATCCACACTCCAAACAGGTGGCCAAAACATCCG
TGGGGAGCACGTCAACTATCGAACAATTATCCGTGTCCACATAAGCGAGTGTATCGCTGTGTGAATGTGCAAACACAGGCCTCATTAGCACATGATGAAG
CACGCTGCATCTTGGGCACCACTTTTGCAGTTTCGGAGAGTCTATACTAAGTACTGCATCAAATTGGAGTGGGCAGTCGTCACACTGGACTTGGCAAACG
AGGCGATGGGCAACAAGCGTGCCAACTTGGTGCAAAACCAAATCCTCAAGACGGATTTGAGTGCCCTTGACATCAGGTTCGGTCTCAATAGTGACGCGCT
GCTCAGGAGGCGTAATTTTATGGTTATCGGTAAGAATCTGGAGATTTATTTTTTCCGCTGCAATATTTTCGTTTTCCGCCGTAGTGCAAGCGGTGACAGT
CGCGTTAAGATCAACACCGCGCCGCACAAGCTCACACAGCAATTTAAAACGATCGATACACTCATTCAAAGACTTCCCCTCGACTTCCTTTGCAACGTTC
GTCCATCTTTTCTTTTTATCCATTGTTGCTGGATACTTCTTAAGGGCCACATCCAGTGCTCGTTGCTGCGATTCGGACCACTCTTGGCTATTTTTACTTT
TCACGCCGCAATTTTCATATCCAGAGATATGTGAAGAGTTTTCATTCGTAACATCCTCATTCGAAGCTGTTGCTACAGATGTAATTTTACCAAGTATACC
AACGACAGCAGGTGGCAGGGGAAGTGATCTTTGTGTCTCAATGTACTTCTTCATCCCGGTATTTTTAACCGTGTGCAAGAACTTGCAATTGTCTCCATAG
CGACACTTACTCTGCGCAAAAAATATACATCTGCGCACCATACTTTTTCTGCTTTTTGTTAATTCTGCTGTAGCCACGATATTCCTTTTTTCAGAAGGCT
TTGCTGGATCAGCTTCGCTATTGATTGAGAAATCGTTTACATCAAAAGACACTAAATCTCCACCACCATTTTCAGCCTTCAACTTCTCATTTTCGATATG
TGCAAACTTGCAAGTTTTTCCCACTCTGCAGAATCCTCGTACGAAATAGCGGCAATGACGCCCTGAGCCTCGTTTTCTATGCTTTTCTTTCTCAGATAAA
ACCCGATTCGCATCTTCTTCCCGTGTGATTCTCAATTCTGCCACTTCTTTCACCATCTCATGATTGATCTCGAATGGAGCAATGACACACCAAATATTAT
TGTCAATCCAGGTCAGCAGCTTCCTTAGCGCAAAACCTCCACACAGCTGCTGAGCTTTGGCACCCACCGCGATGTTCAGCGCTTTAATCTGATCGTTCGA
CAGTTGATTGCTCCATTGCACAAAATCCACTTGAACAGGgtctactggatacttttTTGGCAGCGTCATCTGCAGTTTCAATTGCCCTTTAAATCGCGCT
GGCAACTCTTGATCTGATAGACTCAAAAAAAGACACACATGTTTGACCTGCTTCTCAGCATCTAAATTACATAGCTTCAAATGATAACGGCGTTCCAAAG
CCATCCATTCTCTCTTGGCGGCGTCCGTCTCGCGCACCAGCGACTGTTGCCAAGTTAAGTCGGCCATTGACAATTTTGCTTAGAAAAATCACCTTTTTAG
TTTCATAAGGAATTGGTATAAAATTTCGCTGCACCAACCATAGCGAAATATTCTTCTAAATTATGTGGAGTATCCGTATTCGCGGGCCAGGTGGGAAGCA
GGTCGTGCTTAAGGTCGAACCTGAGACCACTTTAAAGTATTTATCAGGTTTGTTACTCGTGGACGTACTAGTTTATTGGTGTaattggcggctttgctcC
ATAGAACTGGCATCAAAAGAGCTGGGCCTGAAGACCAAAGACCTCCTTACATGTACGCAGCATCGGAGCAGTAATGATTGGCCTTATTTGACACCTAATA
TACTGGTTGCAGTTTGCACAGGGTTTCCACCTAAACCTGTGAAAGCGGACAGCTTGACACTGGTGAATTCTGTCTTTGAGCCTAATGACACGGTAGTTGT
TGGCAAAACTTTGAATACGGTGGATGATATGCTTCCTGCGAACAAGTCTGCTTCTAGTGCTGCAAAGATTACAAAAAGATTCGTGAGACCAACTCCAAAA
AATTCCGATGCTTTAGCATCGAAAAGTGGAGTGCACACGTTGAATCCGTCGACTAGCGCCAAGAAAAAAACTATACCGAAGCGAAAAATACCAGGTACTG
GTCACCAGCTCGGAAGCTCATTAGGAAATAGCGAGTTTGAAGCTGCTGAGCTGGCTGGTGAAAATGAAAGCGAACCGCAGCGTAAATTTCGCCGTAGTAA
AACTATCAATCTTACTTCCAAGGAGGATGTCGAAGTTAATTTGGTGAACGCTGTTAGTGGTCAATCTCGCGATCGTGCCGTAAAATTTTTTCGAGCTGTG
ACAAGGAATGCAGTGGAGCATCAGTATGAACTTACATTGGCAACCGCGAGGTTAAATGCAGCATTGGCACATAATTTTGAGACTGAAGAACTTTTGACAA
TTCGACGCGGTGATGGAAGCGCGGCAAAGTTGCGTGTACGATTTAAGGAGACACCGCGCAAATGGAAGGAAGAAACAGTGgattttttgaagaaatacGA
GCTGCAGGCCATTTTAAAGTATGTATTGCTGTCAGGTGGTGAGACTGGTCGCGAAATGCTGAAGCCATTTAACATGGCACAAGTGTCGACGAGAGTATTC
TGGAGCATCGCGCACATGTACGACGGGAATGTAGCTGAAGGACTAGCAGACCTTGTCCCCGATGAAGATTGGTCGTTTATTGACATTCGTACCCGGTCGG
TCATGTAGAATTTAACGTAAGACGAATAAGATTTGCTAACCCATGACATATCCTGGTGTGAAATAGGGTTCTGTCCGAGAAGGCCACGGAGGCAAAGGTA
TTGATTAAGTAATTACTTCTTTGTGTTCTTGCATTTGGATATGGGTAATTGCCTGTGATCGTGAATGTCCACAATTAGGCAAATGAAGAACAGTATAAGC
TTTGGAAGCAAGGcaagcaaaagaaaaagtgCGCATCATCTCCGAGTCCCAAAATGAAAGGAGCTATAGCAACAGAAcgtcaaaaaaatctttctgTGAA
ATCATGTGAGGACGAGAATGCCAGCCATGAGCCCGTTGTATCAAAATGGACCTCATCAGCTCAAACCCTTGCTCTGACTGCGAACGTAGCAACTTCAAGT
AGTCCACGCACTGCATCAGCTCGCGCTGCGTTGACTCGGTTTGACCGAAATGCCCAGGCAAACGATGTTGTATCCGTTTTTATTAAAAAAGATACGACAA
TCACTGATAAAGAAATTGGAGTCGAAGAAAAAGTATCAGAATACGACGTAGAAGTCGAGGAAGCAACAACCGTCTACTGCGATATCTGTGACAAAGCGCG
CATTCTATCTATCGCGGAAGCAGCAAATGCTGAGCTGGATAAAGATCCATGGACGTGTCTCAGCTTGGTAAAAGTTGGACGCACTGGTGGGTGCAACACT
GTTGATGATGAAGTAGCTCAGATCACGGGCACTGAGATTGCTTGGTGGCTGCAAACGAAAGCTTCTATCGTTACTAGAAGAGAACTGGCGGACGCTTCCG
TAAATGCAATAGTGCAATTTCTCGTAGATCCGCTAGATCCATCAGCCCAGATGGTGCAGGAGAAGCTGGAAAAGTTTATTGATGAGGTATGTCGACTTTG
CTCTAATGTGTTAGGCTCTTACCAGATTATTACTGTTATTTAGGCTCgtctcgatgagattaaTGAATGGATGGCGGAACTAGTTGGCGAGTTTGATTTA
GTGCAACGGTTGGAGCTTCAAAAGCTTGGCACACCTGCTGATTTAATCGCCACTCCTAGCGATTTGATTCTCGCAGCAGTTGGCAATTCAACCAGTGTGT
CTCTCGACGAAGTCAATTCCTGGCAAACTCGGGCCAATAGTCTCATTAAAAAGCATCCGTGGTTGATGAAATGGCGGACTCTGTAAGCCAAATATTTCCT
ATTTAGTAACTAATGGTGCGTCGACAGCAAAATGAAAGCAATTGAAATACATTTTCCTCTGGCTTCTTCTACACACGTAGGAAACACATGCATGGCTTGT
ACTAATTAGCGTTAGATTGACCAGCTGTCGGCCGAATAGTCTCGTTGTTTCGCCCTCATCACCAATTTCTTACATCGCTAACACGCTGACGTACTTagtc
aattttaatggaGCCGTAGATCTTGCGTGTAAACCAAAGACAAGCGAGGTATCCGATTGTTCCggtcaaaaagaaaaaggtgACCGAGATCAGGAACATG
TAGCCAAAGTACAGGACACCCGAAACAAACGCTGTGATGTTCAACTTGGTAAAGAAGTACAGGAACGAGTACAAGAACAAATACACAGCCGCGGATCCTG
ATGTAAGAAACGAACGCCACCACCAGCGGTAATCCTCTGCACAAAGCTGGAAGTAGCACATCACCACCGTCACTTCTGCGCACGTTGCTACAAGAATGAG
CAAAACAATAAACAGAAAACCAAAGACGTAATAAATCTGGTGCAACCATAATGCCGACATGATGAAAAACAACTCAATGAAAACGGCGCCAAATGGCAAA
ATGCCACCCACAAGAATGCTGAAAGGCGAAGACAAGTACCACACTTGTTCTGGAATTTGACGCGCAATTTGATTGGTGCGCACAGGTTGCTCAATAGCAG
CTGCCTTGAAGCCAAAATAACTGCCAAGAAATACGAGTGGGACAGAAATTCCAAACCACAAGACAAGGAGAGCAAAAAGCGTTCCAAATGGCACAGCCTG
CGAAGACTCCTTGCCCCAAAGTACAAGATTGAGCAGAAAGAAGACACCAAAGAGAAGGCCAGGGTACAACACAGCCGTAAGAATCGTATTTTTCTTCCAG
TCCTTGCCATTGAACATCTTATACGTCCGAGACGAGCTGTAGCCAGCAAAGCTACCCATAAATACAAATAGCAACAGCAGTGTCGTTAGCAATGAACCAC
GATTAGCCGGTGATAGCAGACCTAGGAGTGCAATAACCATCGTTGACCAGCTCATGCAACACACCTGAACACCTGTGCCTACAACGACCGAAAAAAGCAT
AGGCGACAGTTGCGGCGGACGGAACACATCACCATGGACCAGTTTCCATCCCGATTCCTCCTGAGCTTCTTCGGTCGTCTGCACCTCATTGTAGCGAGCG
ATATCACGGTGAAGAGTACGCAACATGATCATTGCGATCATTCCCGTTAAAAAGAGAACAATCATCAGCGAATTAATAATGGAGAACCAATGAATCTGAT
CGTTCGAGCTCTTGCTGCTAATAATGCGATCCCAACGTTCCTCCCACACAATATCCGACTTGATAAACTGCACGTCGTATGTGTATAAGACAGTAGTTTC
TCCTGCGGGGTTTAGATATTGATAATTGCCCTGAGAAACCTCTTCGATATTGATAAATTTACCACATGTGGCTGAGTCGAGTTCTTGTCCTGCCATGGgt
tcattttcaaaagtgTGCTGAATAGAAGTAGGTACAGCTTCGAAGCCTACGATGCGCCACTTGGGAACGTCTCCATCCTCTTTTGCGTAAGGATCTGGAT
TAACTGAGATGATAATGCGCACGTGATTGTAAAGAAGGTACTttccatcttcgtccacttcTCCTACGGGAAATCCACGCTTGAAAGATCCCGCTTGCTG
CGAGTCGGTCGGATCGCGGTACAAAACCGGCAAATTATCAACTATCCACTGCACGTAGTACTCGTCCTTAATCATGTCAATAAATAACTTTGACTGCTCG
GGCGTGTACTTCATGGGCTTACACAACACTTGACAAATCGCGTCTTTCTCCATCTGCAAATTGTAAAGCGAGTCCATAATAGTATCGCCAGCCATAATTT
CACCTAAATTCTCTTGTTGCTCATTAATAGCCGCCGGTTTACAATACGGGAGATAGTAGTATTCATATGGCATCAACGTTTTCGTAGATGTAATCTTGTT
GACATTCAGGTGGACTGTCTCGCCTGCAGCCCAAGACTCGGGTGCTACACCTGGAACATAGAAGGCAGCGCCAGCCTCATCCATTGCTAGCAGCGCAGCT
AGCGATACTGCTAATATGTTTTTTGTCTGCATAACGAAGTAGACTTGCCAAGGAAAGACCAAGAGAGGGGAGACTGCTGGCTTCTTTGCGTTTTGTAGGC
GTCTGGGGGAGGAGTGTGCCACGAAGCataaagtaaaatttaaattagCTACCTCTTAAACTTGATGAATGga