Description :
From Genome Similarity Track
Location :
Scaffold_53:61923- 62926
Transcript NameFunction/comments
Phyca_LT1534510022DEAD box ATPdependent RNA helicase putative

Sequence
1003 bases(100 bases per row)
cagggttcgagaaaccttcagccattcagcaacgcgccatcaagcctgctatccaggggcgtgatctgatcgcccagtcgcagtcaggaacaggcaaaac
ggccgtgttttccatctccgtgttgcagtctctggacacgtccagcaatgaaacgcaggctctggtcatctctccgactcgtgagctggcggaacagacg
cagaaggttgtgctggctctaggagactttatgaacgtccagtgtcacgcctgtatcggcggtaagagcgtgggcgaggacatccgtcgcctggacttcg
gtgtacaagtggtttccggaactcccggtcgaattttcgacatgatccgtcgtcgcaacctgcgcacacgcaacatcaagatgctggtgattgacgaggc
ggatgaaatgctgaacaaaggcttcaaggagcagatctacgacatttaccggtacttaccgccgtcgactcaagttttactggtgtccgctacgatgcct
caagaagtgctggacttgacgcggaaattcatgaacgagcctgttaaagtgctggtgaaacgtgacgaattgacgctggaaggcatcaagcagttcttcg
tggctgtggagaaggaagagtggaagttcgatacgctgtgtgacttgtacgacaccctgaccatcactcaggctgtgattttctgcaacacgaagcggaa
ggtggattggctcacatctaaaatgcgtgaagccaacttcacagtgtctgcgatgcacggtgacatgccgcagaaggagcgagacgcaatcatgcaggag
ttccgctcgggtgggtcacgtgtgctaatcaccacggacgtttggggtcgtggtcttgacgtgcagcaggtgtcactggttatctgctatgacctgccga
acaaccgtgagctctacatccaccgcatcggtcgctccggtcgtttcggacgcaagggtgtggctattaactttgtcaaggacgacgacattcgtatcct
gcg