Description :
From Genome Similarity Track
Location :
scaffold_83:61910- 65610
Transcript NameFunction/comments
g3074.t1 hypothetical protein PHYSODRAFT_543861

Sequence
3700 bases(100 bases per row)
ATGGACTCGGAGGGCTTCACGTCGCGCGCGTGGCTGGGCCACTGGGTCTCGGGCGAGGAAGAGCCCGTGAACAACTACTACGAGGATCACAAGCTCATGG
AGGGCGCGCTCATCAAACTGGGCGACTACGCGCACTTCCGCTACTTCCTTCTCTTCCGCAACGGCCGTTTCTGCTACTACGAGCTGCCCATGCCCGCTGC
AGCGCCCGGAGGGGGACCTGAAGGCCCCAGGAGGGTCCACCTGACGCTCACATCCAAGCACCTGCGCGGTGTCATGATGCTCAACGCGTCGGTGAACGCC
AAGGACCTGGCCAAGAGCGAGGACGAATACGACGCCGACCTCATCAAGCGCGGACTCGTGTTCAACCGCAAGAAGCTGGAGATGCAGCTCACTGGCTACT
CCCCCACAGGGCAACTCATGTGCTGGAAGCTGCGGGCTGGCAAAGACGCCGTGTACCTCAAGTGGGAGCGCGCGTTTCGCCTAGCGCTGCGCCCCATTTG
GGTGCAGAACTCCAAGTGTTGCATGGTCTGCAAGAAGGAATTCAGCTTCTTCATCCGCCCGCACCACTGTCGGTACGTTTAGGTATTGTTAGGGCCCTTT
GCAGAGTGAATTATTGACGTGTTGTCTGTTTTACAGCAAGTGCGGCACGTGTATGTGCGACGAGTGCTCGGTGTTCGTACCACGGCTGCCGATGCAGGGC
TACTACGATGAAGTGCGCATCTGTCGGGACTGCTCGCCTATTAAAATCCAACGCTCGTCCTTGAAAATGGGCACGCGCGTGCTCGTGTACGGCGTTCTGG
TCGGCAGAGTGGTGCAGGTTGATGCTGCAGACGACTCGGCGGATGGAAGGGCGTTTGTGAACGTAGAGCTGGTCAAGAAGGACAATCAGCTGCGTCGGTT
TGCGCTGGAGCACGTGGAACTGTACTCCGACGCCGTGCTGTCCGCCAACCGCATCAAGAATGCCATCCGCCAGCACCTGTCCTACGCTGTGCTCCGAACA
CAACTCAACTTCAACACCTGGAACTTGCTGGAGACCGTTCAAGAGCAACGCACAGTGCAGATGGTGCGAATACTCAACAAGTCGACGAGTATCAACGAGC
TGCATTCGATGGTGCCGATGCTCGGGTCGTTGGATACGATGCAGTTTCCGGACGACGATGTTTCTGAAAAAGATCGCGTGAAGGAATCGCTGTCGCATTA
CCGCGGCGTGCATGTGTGCTTCCCGTTGCGGCTGGATACAGTAAAGAAGCTCATCAACCAGTTCCGCAATGGCATTTTGCTCCACCGTGTCTTCGTGCGC
CAGATCTTGGATGAATCGGAGAAGCTGTTCCGGAAAATGCACGAGTCGCCAATGAACGAGATCGAGATTCCGATGGGCGTACAGTTGGTTGTGGTGGGCG
ATCTTCATGGCCAGTTGGAAGACTTGCTTACGATCATGGACAAGAACGGCGTGCCCAGCAGTAAAACGTGGTATCTCTTCAACGGCGACTTCGTGGATCG
CGGATCTCATGGGATCGAAGTCATCCTACTCCTGCTAATTTTTAAGCTGCTGTATCCCGACTACGTCTTCTTGAACCGCGGCAACCACGAGGAACGAATG
ATCAACGAAGTCTTCGGGTTTGAAGATGAGGTGTACACGAAGTATGGCACGGACAACGACGAGGTTGCTGGGTGGAGTGGTCTGGGTACTTCGATGAATT
ACTCGCCAATGAAGCTTTTCCAGATGTTCGAGACCGTTTTCGGTCTATTCCCGATCTTTGCGTTGCTTAACAAGCGTGTCTTTATTGTGCACGGCGGTTT
GAGTAACCACGAAAACGTCACGATCGAGGAGCTTCTCCAGCTTGACCACAGACGTGAAATCCCGACTCAAGGGACGAGTCGAGCGGACGAGGTTTTCACG
CATCTTTTGTGGAGCGACCCACGCGACGAAGACGGATGGAAGCCGTCTAGTCGAGGCGCCGGCGTGGAGTTCGGGCCTGATATCACGAAAGCATTTTGCG
CACAGAATGGAATCAGCCTCATTATTCGGTCGCATGAGTGCCGGGAAGAAGGTTTCGACATCGTTCACGACGGCCTCCTTCTGACGGTCTTTTCAGCGTC
AAGCTACTGCGGCTCCCAGACCAACAAAGGCGCCTACGTTCAACTGGAGTTGGGAGAAGACAACGAGGTCAAGCCGCATGTGGTTCAGTTCTCCTCTCAA
CCTCTTCAGAAACTCAAGGATGCCGGACGAAACGAGTGGCGAAAGAAAGCTCAGCGGTTGGAGCGCAGGACTCTGATGTCCCTCGTGGAGATTATCTGTG
AGAAAAAGAACGCGTTGCTTTCCGCATTCAACGAGTTGGATACTGCTGGCTCTGGGCGTGTCTCGAAGTTAGAGTGGAAGGCGACTTTGCAAAAAGTGCT
GGGTATTGAGGCGAGTTTCCTTTCGTATTTCCACCAACTTGCTGAGGAGGAGCAGGATGGCGGTGTCGATTACCAGAAGTTCCTCAATCGCTACACAGTT
GAACTGGATGGCGGCAATGTGGAGTGGAGGCGCAACTTGATTCGCAAGGTCTGGATGGGGTTCTGCCAGGCGCTCCCGCATCCGCCTGAAACAGTTTCAG
AAAAAATGACATTGCAGGACAAGCTGCACTTCGCGTTTAATTTGTTCCAGTCCCCCCCGCCTGGGGCTGCGATGAAAGAGCTCCCATCAAATCCTGTTTC
GAGGCCCGAAGTGGCCGGGCTACCGAGTAGTTCCTCTTTTGGTGACAAGTCGAAGGAAAGTTACCTGCGCAATAGTCTCGTGACGTACGAGGTGTTCCGA
AACACCATTCAGGGCAAGCTGCAACTGGGCGATACCCTTTCCGAGCAGCAGATCTTCGAGCTGATGCAGCACCTCGACCAGAACCACGATGGCGTGGTGG
ACTACCAGGAGTTTTGCTCCTTCTTTGCCGAGTTCAGCCGGACTGATTATCTCCAGGAAATCTTCGAGGTGGACGACACGAAGGCTATTTCGCTTTTGAA
TCGCTGTGCCACATTGCTGCAGAGCCCCAATAAGTTCAAGTCACTGCGGGATGCGTTCGACGCACTCGACCACAGCAAGACAGGGAAGTTAACTGTGGAG
GACATTTGGAAGGGGACACAAGAGTTGAATATGGTGCCCGAGTTGGACAACGAGGAAGCGCAGTTGCTGTTCAATTCGATCCTACTCAGCTACTACGGCA
TTAACCATCGGGCTCAGTGGGATACGCGGGGCTTGGACTGGGTCGTGTTCGAGGACACATTCTCGCCGGACAGCACCTTCCAGCGACGTCTGTGGCTGGC
GAGTCTGGGTGCTTCGAACACGAATCTGGCAGCGCTCGACGTTCGTGACTCGCTGTCTGGAGACGACGACAGCGACTCGAAGAACCAGGCGTGGGCGGAC
ACGTTCGTGGACAGCGTCAAGCAGTCGCTGCATGAGCAGCGTCTGTATATCAAGTTCCTTTTCCGGATAATGGACCGCAAGCGACACGGGTACATCACCA
AGGAGCAGTTCGTCGCCACGATGCAGGCCATCAACGAGGAACACGGTGCGCCGCTGAAGTTGTCTCAACTCGAGCAACTGGCTGACGCCTTCGCGCACCG
AAAGACCGTGCGCCGCATGTCGAACGCTGGCGAGGAGACGGAGGAGACGCGAACGTATGTTTCGTACCCAGAGTTCCTGCGCAGTCTGCGCATCATCGAC