Description :
From Genome Similarity Track
Location :
Scaffold_192:6190- 8447
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_192-snap-gene-0.12Pogo transposable element with KRAB domain (LST003/SLTP003).
Pytiw_DAOMBR242034maker-piw_contig_192-snap-gene-0.18Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_192-snap-gene-0.19ATP-dependent RNA helicase dbp4

Sequence
2257 bases(100 bases per row)
ACAACTCTACCTGTAGATGCCGAGCTGTAGTTGGTGAAACGGATCAACGACTACAGGCGCGACGGCGTGCCAATATCCACCGGCATGTTGTCCCTTCAAG
CGTTTGAAGTGGCTGACGAATACAGCATTCCTCGGGGCGTCTTCTCGGCGTCGTGGCAATGGCAGCGGGAATTTATGAGACGACACAAGTTTTCATTCCG
TGCCAAGACCCATCAAGGTCAAATCGCGCCCCCAGATGCGCTCCAGCGCGCAGAAGATTTTGCGAGAGAAGTTGCCGGGTTGGCTGCTGTCGAGAATGTC
AAAGTGATCTTCAACGCAGATCAAACTGGAGTGTTCTTTGAACTCCTGTCACGCCGAACTCTGTCTCCAACAGGAGCCAAGACTGTGTGGGTGAAATGTA
GAAAAAAAGAAGAAGCGCTTGACGGCGATGCTACTGGGGGATACCGATGGCAGGAAACACCCATTGTTCGTAGTTATGAAGGCGCCTCCGTCAAAGACCC
CTGAGGTTCGGCTCAAGAACACACGATCTCGACATGGTTTCGGCAAGCGCGCTTGGGCAGAAGTCAGTCAGCTGCAGCGAGAGCCCAACATGCAGATCTA
CGGCAACCAGAGTGCATGATGGAACAGCTCTATGACAATGCACTTTTTGCAATTTCGGCGAGCGCTCTGTCTTCAGCGATCCGGTGATGTTGTTGCTTGA
TGATTTCAGCGGCCGTTGGACCACTGAGGTCAAAGCTTACGCTACCACTCTCAGAGTTTTTCTGGTGAAGGTGTCGGCAGGACTGACGTGGATCTGTCAG
CCTGCAGATGTGGTGTTGATCAAGCCAGTCGAAGACCGGCTTCGGCGTTATTGGGTGGAATTCCTTCGACAGCAGCTTGCGGTGCACAGTGCCAACCAAG
TCGGAAGCCCATTCGAGATGAAGGCGCCGGAGAGAAGCGACGTCGTAGCGTGGATCTCAGACGCGTGGAATGACATTCAAAGCTCAGTCATCAAAGCAAG
ATTTCGAAAATGGTTGGTCGACTTGACGCTTGAACCAGAAGCGTATGAGGAGAACGAGACTCCAGAAGATCAAGCCGCCGTTGATGAGGTTGTGCAGATT
CTGGGAAATTTATCAGGGCTTTTTTGTCTGTTAGGGAGTTAGCCGATGTTGACGACATCGTCGACAGCCATTGCATGTAAAGCTCATCATTAATGCGGAG
GCTTTTCATCATTTCTCTTCTTCCTATGATCATTTGGTTTATAACTTCAATATGGTTCTCGGTCAGAGCAGCTTCATGCGAAGCGCTCGAGCTCTTGCTG
GGGTCCTTGCTTCTCACTTGGCTCGCACATGGTCTCGTATGTGAACTGCACCGGATTCAACATGAGCGAGCTCTTGGAGACGGCAGCAGCGTCTTGCCCT
GCTTGTTGAAGCACGCCGCGCGACGGACTCCTGGATGTAGTTGGCCCCATCCTCGGGGCAGGCGAGCTGCACGACTCAATCGACCTGCGCGAGGTCGAGG
CCACGCACAACAAAAGTCGGTTGCGAAGAGCGCGAGATCTCCACGCGCTTGCCCTGGTTGTACTTGCCATGCAGCACCAACAGGGATCGTGGACAGAAAC
ACGATCGTCATTTGTTTGAGGTGCGCCCACCTCAACGAGAGCAGTACGTCAAGCTTCTTGTCGAGGCCGCAGACCACGTAGCTCTGCGCGAGGTCGCTGG
GCATCGCCAGGGCCGACTTATCGTGCACAGCGATGTACACGGGTTTGTTCAGACTGAAATTGACGAGGTCTTTGGCTCATTTGGTCTGCGTCGCCGAGAA
TAGCACCGCCTGGCGCGTCAGCAGCAGGAACGAAATGATGGACGTGAGATGCGCCTGGAAGCCCATGTCCAGGAAGCGGTCGGCTTCGTCCAGCACGAGC
ACCTCCATGCGCTACAGCAGATGACGAGGCCCGCGGAGAGCGAGTACCTCTTGCAGAGTGAGCGCAGCACCTCGAAGATCTGGAGCGCGAGGTCGTGCGT
TGGCGAGATCGCGATCGAGTCCAGATCGCCCTCCGCGTCCCAGCGCGAGCGGTAGCGCTTCTCAATGATCAAGATGAGGAACGCCAACACTGGAGCTGGT
CTTCGTGCTGCGAGGCAACCGCCAGCGTGTGCTTCCATTTAGTTAATCAAGTTGCACGCCGTCGTGCTGTGCTCAACGCTTCGTTCCTCTTATGTCGCCT
AAAAATCGCAACAAATACACATACCAGTCAGAAATGACTCCGTAAGAAGCTCTAATG