Description :
From Genome Similarity Track
Location :
Scaffold_179:619- 2218
Transcript NameFunction/comments
Phyag_g3137hypothetical protein

Sequence
1599 bases(100 bases per row)
acatggaggacgagatgaagcaGGCTGTGATCGAGAAGGCCACAAAACTCTACAACTACTACGAGGGTGAAAAGGATAACGACACCAAGATCGCTCAAGC
TCTCAAGGTAGTTGGTAGCTATTCATTTTGAGGAATTGAGGTGTTATTAACTGTTTGTGTGCATTGCTATAGCACTCGTTGACGTTCACTTATGGCCCGA
CGTGGCAAGTGGTGGTCTCCTCTTCCCGTGAATTGTGCTGCCTGCCGATAGCGGATGAGGGCACGCACGCTGACTTTACGGTGACAAAGCTGCGTGTTGT
AGTGTATCGCCATGCGGGGACCAGTCTGGACCGCCACTTGGACTCGGCGCAGTTTggcaagcgcgtggcctTCGTTCTCGCCACGATCTGTCTGCTGCTC
TATGGATTCCTGTCGCTGAACTCGTCGGAGGTGATTCAGAGGTGCAAGGGTGGTGTGGTCGTTGCTAGTGAGGGTATCCCGGTCGATGGCGTTGTCTTGC
CGGAGGGATGCTCGGCGGAGGATGTCAAGCGTGCGAATGACCACGCGTGGTGGAAGACTGCTGCGATTCTGGGCATGTCGGCCTTCACGATGATGGCGTC
ACTCATTCGCATGTACAGCAAGTCGCTTACCCCAAAGGTCAAGCGCGCGTAGAGCAAAAGTATCGAGGAGGGTTGTCGCCGCTGTAGGCATTAGAGATGA
TAGAAGCGCAATTTGTGCGAAGTTTTGGACCTCAAAGCGAACTGGAGAATGTGGTTATCATGAATCAAGCAGTGTATtcgtttggtggtggttgacTCTC
AACTTGCAGAGTTCTGGTACCGCACGCACAGTGTGCGCCACGTGGTTTAATCGTCGTGATCATGTTGTCTTGATCCAAGCTGAAGGCCTACTGCTCATGC
TTTCGGGTTATGCTTGAAGgaaaaacttcaacttcagctcaCGAGATTTGCCAAGCACCAGACAGCGTAGACCCTACGCTAGTCATTCTCCAACCCACCA
TTGACCACGCACTTCTTCGCGAGTGATGCTGCCATTTCGCTTTCTGGGTGCCTTGGTGGCTATTCACACGATCTCGATATCGGTATCGGCTACGGAGACC
TGCGGCGATACCTCGGTCATTTCAACCACTTCCAGAGCAACCAACTCTGTGACTGGAAGCAATGGTAGCAACAAGACCTTGTGCTTCGCATCGGATTTTC
TCTTTGGTACTGCATCATCAGCCTACCAAATTGAAGGTGGATGGAATGCTACGAACAAGGAACCAAGTATCTGGGATAACTTCTGTCGGGACACCACCAA
TGGTGTTCCCTGTGCCAATGTAGCCGACGATTTCATTCACCGCTACGATGGCGATATCGCTTTGATGAAGGAGGATGGCTATGGCACGTTCCGGTTTTCC
ATCGCGTGGGCACGTGCAATGTCGTGGAATGAGACAACGCAGCGTATGCAGGCGAACCCGGAAGGTTTGGCGTTCTACCACTCGTTAGTCGACGAATTGC
TGGCCAACGGTATTCATCCCGTCATGACTTTGTACCATTGGGATCTGCCAGCTACACTGCAGTCGACGTTGGACCCCCCTGGTTGGCTCAACGAGGCCA