Description :
From Genome Similarity Track
Location :
Scaffold_6:618958- 621728
Sequence
2770 bases(100 bases per row)
AACTCCCACCGGATCGAGGCGTATGGCATGAGATCGATCTCGTCCCTGGTACGAAATACTGTGTCACGAGACAATGGCCGCTTCCACGCGAACAGTGCGA
GGTTATCGATGCCTTCTTCGCTGCGAAAGTGAAGGCAGGCATGGTGCGGGAGTCAAAGTCCCCGCACTCGACGCAATCCTTCTGCATTCGGAAGCCGAAC
GGGAAGTGGCGTCTAGTTCACGCTTATAACAAGCTGGACAACGCGACGGTACCGGCCCAGACACCAATCCCACGAAAGGATGTGTTGTTTAACATGGCCG
GAAGCGTACTGTACAGTGCGCTGTATTTGGTAGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGG
CATGCTTTGGGAGTGGCTCGTCATGCCACAGGGCTTGTCTAACGCCCCGGCGACATTCAACCGCCTGGTGACGCAACTGTTCAGGCCATTGCTCGCCTTC
GTACAAACGTACTTCGACGACATCTCTGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGATGTGCACTTGGGGCAGATCCGTCGGGTGTTGGACG
TGATGCGAGCGAACAAGCTCTGTACCAACATCGACAAGTGCTTCTTCGCGTCACCAGAGAGCAAGACGCTCGGTAGCTTCGTCAGCAACGTGGGCATTCG
AGCCGACCCAGACAATATCATTGTCATTGCAGTGAGACCAATGCCCAATCCCAGAGAAGTCTTCGAAAGCGGCTGGGCTTGGCCAACTACCTTCAAAATA
TCGCAGCGTTCTTCATCGATGTACGAGCCTAGACAGCGCAGGGTACGCGGGCCTAGCTAAGTCTTGTTGGGCCTCCTTCAGAAGGACGCCGACGGGCACT
GGTAGCGAGAGCACCAGGATGCGTTTGACAACATCAGGGCCAGTCTCCAAGACTCTCCTGTCCTGGACCTGCCGGGCGAGACGAATCCGTTCAGCGTCAT
CTGCGATGCCTCCGACTATGCAATCGGTTGGGCATTGCTGCAGGCCGACACGGCTGGACGTGAGCGAGTCATCTCGTTCCCATCCAGGCAGCTCAATGCC
GCCGAACGGAACTACCCTGTCAACGACAAGGAGCTCCCGGCAATGAAGTATACCCTTGTGAAGGTTTGGGCTCACCTTCTGGGCTCACCACCCTTCGTGA
TCTACACAGACCACGAATCCTTGAGGACGGCGACAAATTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTTATGTTTCACGCAGTACAACTTCCG
CGTTGAGTACAAGCCGGGCAAGTTCAACGTGCTTACGGACGCCCTCTCTCGGTGTCCAGATTGCGAGTTGTCCTACTTTACACGGGTGACAACGGATCTA
TAGGATCGGATCCGCGTGGCGTGTCGGGACGATGAGGCTGACGCACCTATCGTCAAGTTCCTAGCAGGAGGAACGAACGCGAATTCCGACTGGCTTTCGT
CGCGACAGCGCTCCTGGCTCCACCGATACGAGTTGAATTGTGGCCTCCTCTATTACTGGGTGGAGCCTAGTGAACCTCCACGGGTGGTCGTACCCAACGA
CGAGGATCTGAAGTTTGACATCCTCGCGGAGGCGCACGATGTGCCCTCCAGCGGCCACTTGGGTCGTGAGAAGACCTACCGGTCGGTCACGCAGGCCTTC
TGGTGGACCCACATGTACAAGTGGGTCGCCCGGTAGCCCGGTACGTGAAAATATGCGAAACAAGTCAGCGGGTTAAACCGCCGGGCACGCTTCGGCTTCG
TTACAGAGCCTGCCCGTTCCGGCCGACTGTTGGAAGTCGATGCGTCTTGACTTCATCTTTGGGTTTCCCGCCGACGGACACGGCAACACCGGGATTTTGG
TGTTCGTGTGTCGGCTGAGCAAGATTGTCCATCTTGCTCCAGTACCCGTTACCGTTACCGCCGCAGGCGAACAGACCGTGAGGTTGTTCGTCTATGTCGT
GTTTCGCCATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCGGCGGTTCATGGCCGCGTTTTGGAAAACGCTGTTTCCTTTAGTCGGAACTCGT
CTGCCGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACGGAGCGCGTCAATTGAGTGCTCGAGGACACTCAGCGCAGTGTGTGCGGATGCACCC
CGTACGTGGTCGACGCAGCCTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCATTCTACGTGAACGGCTTCCGTC
ACCCTAGAGTGCCTCTCACGCTTCGAGGAGACGCTGCCTCCTCTATTTCAAGTGAAGGAGAGGCTCGGAAGCTCTTTCCTTCCAGGTCTTAGATGTGAGA
CCGGTTTCGGTGCGGAAACAAGTGTAGTCTTTTATGGATACCAAGCTGAGCGTGATCAGCAGGGTCCGCGATGCTATGGCAGCGGTCCAGGACAGACAGA
AGGAGTACTCTGACAAACAAGGAAGATTAAACTTAACTGTGTTTAAGGTGGGTGGATTATTGTTATTAGACACGAGGAATCTATCACTAGACACTGTCCG
CTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATTCGACCGTTCGCAGTCCTGGCCAGGCATGGTGCGTCGTACACCATCAACCCGTCTAAGTCAATG
ACGGCGCCGCCGACGCTCTACGTTGGACGTCCTAAGCGGTACTATGATCCGCAGCGGGCTGCTGACTCGC