Description :
From Genome Similarity Track
Location :
Scaffold_24:618942- 620239
Transcript NameFunction/comments
Physo_108689putative polyprotein

Sequence
1297 bases(100 bases per row)
ATTGACGTGGAGGTCTATATGGAGCAGCCTGAAGGCTACAAAGTGAAAGGCAAAGAGGACTGGGTGTGCAGATTGAAGAAGAGCCTGTACGGCTTGAAGC
AGGGGCCCAGAGTGTGGTTTCAGCTGCTCAAGTCGTTCTTGGAGGAGCAGGGCTTCACGATGCTGCAGTCGGAGGCCTGCGTGGCTGTTAAAGTAATTGA
TGGGCAGTTGGTCTTCATCCCTCTCTATGTTGACGATCTGATTTTGCTTGCTCCGTCGATGGAGCTCATCAACAAGATGAAGAAGATGTTCGAGGACCGG
TTTGCGATGAAGGATCTCGGGGAGTTAGACTACATTCTAGGCTGGGAGATCACGCGGAACCGGGCCGAGAGAACGATGTTCATTGGTCAGCAAAAGTATG
CCGAGACCGTGCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAAGACGCCGAGCACGGCGGATCTGAAGCTGAGCAAGGCCATGTGTCCGACCGA
AAACGATGAAAGGCAACTGATGAGATCGAAGCCATATCGTGCTGTGGTTGGCAGCCTGATGTACCTGATGCTCGGTACCCGGCCCGATCTGGCCTACCTA
GTTAGGGAGTGCAGTCAGTTCTTGGAAAACCCAGGTCTGTTGCATTGGAGAGCTGCAAAACTTGGATTGCGCTACCTGAAAGACACAGCGGACTGGGGGC
CCCAGCTTGGTGGCCTAGCGTGGTCAGATCAAAAGCTGGATGATCATCTGAGAGCATACGCAGATGCGGATTTTTCAAATCGAGTTGATGATCGAAAGTC
TGTTGCAGGCTACGTGACTCAATTTTGTGGGAGCATCATTTCGTGGAGCAGCCAGACGGAGAAGACCGTCGCGCTGCACACGACCGAGGCCGAATATATG
GCTCTTAGTCTACTGGTGCAGGAGGTGGTGCACTTGCGCCAAATGCTGAAGGAGCTGCAGGTGCAGCAAATTCAGCCATCCCAAGTCTTTGTTGACAACG
AAAGTGCAAAGAAGCTTGCCAGCAACCCTGTGTTTCATTCTCGGACCAAGCACATCGATGTGCGCCACCACTTCGTGCGTGAGCGCATCGATTTGAAGGA
AATTGACGTGCTTCGGGTGCCAGGCGTTGATAACGTGGCCGATGCTTTTACAAAGCCATTGGCACGTCCGGCATTTGAAAAACACAGAGCTGCAATGGGA
TTATTGCCAAGGGCAAGATTTGGAGATGCAAGTTGATGGGAATCCGTAGGTGGGGCTGTTGCGGATTATACTGATCCCCACTATACCACTTGCAGTT