Description :
From Genome Similarity Track
Location :
Scaffold_39:61883- 63310
Transcript NameFunction/comments
Sapdi_VS20SDRG_11082hypothetical protein

Sequence
1427 bases(100 bases per row)
TTGCGGCGCAGCAAATATGCCTCGAGCACGCAGTGTTCCGCCGCCTCCTCGAGATCAAGTGGGAGCTTTTCGGGCGGCGCATGTATGTCGAGCGCCTCCT
GTTGCATCTCTTGCTCTTGGTGACGATGACAATATCTTCCATTCTCTTTGATGACGCGCGGCCGTCGCCGACGACGTATACGATCGGGGTTGTGACCACG
CTTTTCGTTGGCGTTGGCTATGTCGCCGCGCAATGTCTACGTCCGCGGGTCGTGTCCTGGCTGCACGGCAAAGCAGTGCTGCCACGCGACCTCGTGATGC
TCATGGGCGTGGTGACACTGGCACTGGCCGTGCCGCTGCTCTTGTATGCCGATGCACTTTATCTTCCTGTGTGGTATTCCACGATGAACCACCTAACCCT
CGGCGCCACCGTGGGCTATTTCGTTGTGAACGAAATCTACGAGCTGCGCGGCAACCGGGCCGGGTACTGGGGCTCGAGTCTCAACGTGGTGCAGCTTGTC
AACTACACTGCGATCCTCAGTGTGTTTTTGCCCCTGAAACTGGGCTGGCTGCACGCGCCCAACCAGGTGCAAGCGGGTATCGGTGCACTTCTCGCGTCTG
TGCTCTGGGTGCTCTCGTTTCAATTTTTGGAGGTCGTCTCGTCCGCAAGCTACCTCCTCCCGATGATGACGCACCTGTTTGGGGACATTGCAAATTTTTT
CGTGTTTTTTGGCGTCTTTCAGTGCGGCTTGACGCTCATCTTCTACCAGCTCTTCGTGCTCACGTCCGACCCGGCGTTTAGCTCACTGGGGCAGTCGTTC
TCGACGGCGTTCTTTGTCTTGTTTGGCCAAGTCCCGCTCAGCTCTCTCCAAGCGTTTGACGACCCGGCAGATTCATTTGCGCCCATCATGTACACATCCA
CGTCGCTTCTCATGATGGCGCACTCGGTCATCCTTGGCCTCGTGCTCTCCAACGTCCTCATTGCCATGTTCAGCCACACGCTGGAGAAATGCCTCGCAAA
CGCCAAAGCGCAAGCGCTCATCACGTACGCGTGGTGCATCCTTCGCCTCGAGATGACCATGAACCTCTCGGAAGCCGACGTGCTGCGCCTCACGCACGAC
GTTAATGGCGACGGCAAGCTGCAACTGCGACAACTCTTTACCGCACGCGTCCCCAAGTCGAAGCTCGGGCTCGTCTCCGAGCAAGCGGACGCCTTGGCTC
GACACACGACGGCGCGCGCCGACTGGCACAAGCAAATGCAGGCGCTCGAGAACGTCGTGGACTCACAGATTCAGTTTGTGGAAGACGCGCTCTTGCACGT
GAGTCACTTTACTGAGATGAACGTCGCCGTCGCGTTCGCTGGCGAGCTCTGCCTTCTGGAGGCAACGCGTGCTGCGCTGCGAACACTTGTTGCTACCGCG
CGCCAGAGCCAGCGTCCGTTCCGACAT