Description :
From Genome Similarity Track
Location :
Scaffold_46:61872- 62981
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012950Similar to TCHH: Trichohyalin (Homo sapiens)

Sequence
1109 bases(100 bases per row)
TCATAAAATGTAGCAATATCAGATGTTTGATCCACTGTATACGACAAGAGACAACAATAGGGTACGACAGACTGAAGTAATAGTGGTGACCTTCGTGTTG
AATTCTTTATCATGTTAGCCATCCATCCCTGTGATTTCTCCTTCTCCGAGGAGCGTCTTAATAAAAAGTCGTCGTGATGATCGGGCGCGTGACGTCTTTG
CTCGGGCTGAGTTTTTGCAGCACTTTCTGCGTGATCTCGGGCTGCTCGAGTTTCTGAAGCAGCTTTGCATTGATATTGCGCTCTCGGCTGTTCATGAGCG
TGCGCGGGAGATGCAGCGGCGACATCGGCTGGCCCTTGCGCTGCTCCTCCATTTGAAGCACCAGTTGTTCCTGGAACGCGCGGTTCTGTTGTCGCACGTA
GCTCAGTTGTCGTTTCTGTGTCGCGATCGCAGCGCGAGCTTCGCCGTGGTACTGCTCGGCGAATGAGAGGTCGTCGTCGATTTCCTGCCGCTCGCGCTGG
TTCTTCTGCGCACGCTGCACATGTAGAAATTGTTGTCTTTCTAATGCTTCTTTTCGACGCTTCTCTTGCGCTTCCTATAACATGATACACACAAGATAAC
AGGTATTATTACGACCACAGCTTTACCACAAGCGAATCAAAGACCGTCGACGTACTCGTTCTTTCTGGATTGCCACCTCGTCCTTCTTGCGCTGGTACTC
TTCGGCGCGCTTCTCGTCCTCGAGCGTCTTTTGGCGCATCTGCATCTGGATCGACTCGGCGATCTTGTGTTGCGTGTGGTCGCGCTGCTTGAGTTTGCCC
TGCAGCGCCTGCATGCGCTCTTCGTCCTCTCTCGCTAGTCGGCGTGCGTACACCTCCATGAGCTTCACATCCTCTTGCTGCTCGCGAAACTTAATGTGGC
CTTTTTCGCGTTGCACAGCCGAGTTCTCAATCTGCAGCTTCTTCATGCGCTCATGTTCCTGAATGCGCCGCCGTTGCGCTTCGTCGTCCAAACGCTTGAG
CTCGCGCTGCACGCGCTCCACTTCGGCAGCATCCTCTTGTTTCTTTTTCAACACCGTTTGCTCCAACTTCAGCTTCTGTTGACGTAGCTGTTCGTCGCGC
TCGCGGCGC