Description :
From Genome Similarity Track
Location :
scaffold_1070:6187- 8817
Transcript NameFunction/comments
Pl_101392PREDICTED: hypothetical protein LOC100708199

Sequence
2630 bases(100 bases per row)
TAATGGATTGTCTCTCTAAACTCAGCAAGCCGATAGTGCTAAAGAGACGTTTTCTATGTTCTACTGCACAGATACTGGGGCAGAAAAGAGCATCATTGGT
GCTCAAAAATCAAAAGAACTGGAAAAGATGGGCGGTCATGTGAAACCATCAAATTGAAGCGGCCAATAGTTTGTGAGATGGTGGGAAAACATGAGATTGC
CGCGAACTGGTCCGTCTGCATGCACATTTTGGTACATACTACTGCTGGACCTGTGAAACCTTACGAAGTTTTAGTGATTGATGAAGACGAGGATGACTTC
ACAATAGGTGAAGACATTTTGGATGATTTAGGCATAGCATCGAGCTGCAGTTAGAGCAATTGGCTCGCCAAGGGAAATTGGATGATGACGATCCGATCAA
ATTCGATGATGAGCTTTGGGTTGGTAGTGTACCAAATGAAGACGTACGACAAGCGGTTGAGTCAATGATAGACAAAACATTTCCCAACGGAAAAAGTGGA
ACGACTGCGCACGACTATCTACATATACAAGATTTGGATATTGTGTCTTGGTCCCGATCCACCCGCCAAAGTTCCACCACTAGAGATTCGACTAAAAGGG
AGTAAAGCCTTTCAGATGTAAACCAAAGCAATACCTGTCTCACCTTCTGAAATTTTGCAGGAATTTAACGAAGAACTAGTCAGACTTGGTTGGGCCTATG
AAAAGCCTTAAGTCGATGGACATGCCCGGCTCTACTAGTGAAGAAACCCAGAAAATATGAGTACAAGCAAATGACTACTGTCTTTTGAACAGCGAGAAGG
ACCCCATTGCAAGGGTGACGCTTATCCTAAGTGTGACCTCAGAACATGTAAGGGTAATGGGGTTCTTTTGGTTCTTTGACTTCATCAAAGTGTTTTGGCA
GCAACCATCGGCTAAAGCGAGCCAAGAATTTCTGTGCTACGTGACTGATACCAAGTGTTCATGCCGACACGAGTACCTCAAGGATGCTGCGATGCAGCAC
TACATTTTCAAGTCACTATGGACAAACGCTTTAAGAAGTTATATTACGAACACTTGCTCATCTGGGTAGTTGATTTGTTACTCTATATTGATACTTACTT
GGACAAAATTGAAGAGCGTTCTTCGTTGATGCATGAGTTTGATCTAAAGCTAAGCGCGGCCAAGACAATCCTCTTCCAAACTTCAGTTAAATGGCGCGGC
AAGGTTATAGATGGTCATGGCGTCCGTCATGATCCACTTCGTAAGATGCCTTTGCCATCTACTGCACGAGAGCTACAATTATTTATGTATACCTATAACT
CGATGCGTGACAGCCTCATTGGTTATGCAGGTTATGTGAAAACACTGTAAAAGAGGCTTGACGTGACTTTAGGAGGTGGGAAACAAACTAAAAAAAGCGG
CAGGTGATCTACCAGTGGACATCAGCGACGAAGCGCGAGTGGCGTTTGCGTAGGTGGAGGACTGCTTGGCCAATGCTGACATCCCATCCCCAACGGCGTG
CTGTACGTGTTCACCGATGCATCTGATGAGGCATGGAGTGTAATAGTGACTGACGTGAAGCAATGGAAATCAAATGTAGCCATCGCCTAAAAGAGCCATA
ATTCATTGCAATTTGACAGTGGTGATTTCGCGGGTTCGCAGGAAAATTGAATTAAAAGAGCCATAATTTATTGCAATTTGACAGTGGCGATTTCGCGGGT
TCGCAGGAAAATTGAAGTGTACTTGAAAAGGAGGCTGTTGCAATAGTAGCCGCCTGTGATAAGCTGCTGTGACGATGTGCCCTGGAATTTTCCGGGCACA
CTCGCAGCTGCCCAGCCGGGACACTCCGATCAAACTGGGGGGACAAAGAAGATGACTTTCAAGATGGGGTATTGCATGGAACCCCTAAGTGGACTGATGG
ATTCAAGAACGGGAAGCCGGAGCTCAATTATGGACGAGAGTCAAGTATGTATCCTTGGAGACCTTACATTCAGGGTGCGCAATCTGAATGTCGAGTGTAC
ATCCCGAAGACCACTAGCCTTACCAAGTCTAAGCTTTTCAAGAGCTATCCAAGATTCAAATATGTTTTTCCCAAGACACCAACATGTAAACCCTAAGGCT
GACTACCATATGCTGAAAGTCCGGCCACACACCAAGAGACCAAGTCATATATCGAGATCGCGGCGAACAACCCGGACGACGATGTACACCTCGGATAACG
AAGCCCGAATGACCAAGAATAAACCCGAATGGTGGTGTACCCTCAATGACCAAGCACAGCTCGAATGATGCCGTACAGGATCGAGTGCCTGAGTGACTGA
AGTCCAAGAGGTCCAAGTAGGGGCCAGTTCCGAGGTCTATCCTGACGACATCCAGGTAGAGTCAAGTTAGCCTATTTTCTGTGTATTTAGCTTATCGATA
CAATATCTGATGAAAACTGGCATACCGGAGATAAACGACACCTATAAGGATTGCACAAGGTCACACGCCAACGTAGATCAAATCTCATGCTCGATCCAGG
ACCTGTACTGCCTGAAAGGGTTCGTCCTTCACCAAGAGCAACCTTATCAGGGCTCGCTATACCTTGGACGGCAAAAGTGTTCACTCACTTCGACACATAT
CACACTTCAGACCCTCGCCGTTCGGAACGA