Description :
From Genome Similarity Track
Location :
Scaffold_82:61862- 64171
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_82-snap-gene-0.38Myosin

Sequence
2309 bases(100 bases per row)
GGCACGAGATGCTTCGTGCCGGACAAGCGCCGTATGTGGCTGCCCGTCACGGTAGAGTACGTGGACCCGCAACGACAGCTCGTGACGTtcACGATCGATG
GCGACCAAGAGGAGGACGACGACGCGGAACCGAGCCGCATGCAGGTGTCACTCGCAGACCAACCACACTTCCcACTACAGAATGCCCGCGCGGCCACACG
GGGAGGATATGAAGACATGATCGAGCTCAACCACTTGCACGAAGCCGCGATTCTgTTCAATCTCAAGCGCCGCTTCacGGCGCGACTGCCCTACACGTTC
ACAGGCGATATCTGCCTGGCaTTGAACCCGTACCAATGGCTTGAGGAGCTGTACACGAGCGAtcTCCACACCAAGTATCTCGGTGCGACGTCGCGCAAGC
AGCTGCCACCGCATGTGTACGCGGTGTCGGTTGCGGCGTACAAGCACATGGGAGCACAGCGAGAGAACCAAAGTATTCTGGTCAGTGGAGAGTCGGGCGC
TGGTAAAACaGAGACTACCAAGATCCTTATGGATAACCTCGCTCAAATCGCCAACACCTCGTCGTCCAAACAACAGCAGTCCACGATCCAACGCATCCTG
GATGTGAATCCCCTCCTGGAGAGCTTTGGTAATGCCAAGACCAAACGAAATGACAACAGTAGTCGCTTCGGCAAGTTCACGCAGTTGCAGTTCCAGCAGT
CGAGAAGCAAGATGGTGTTATGTGGTGCCAAGTGTGagACATACTTGCTCGAGAAGACCCGGGTCGTGACGCaGGAAAAAGGCGAGCGAAACTACCACAT
CTTCTATCAGATCTACCACGGAAGCACCCAAGAAGAAAAGGTTCAATGGGGTTTAGATGGCGGCGGCAAGTTCACTCaGTTCAATTATGTCGACGATGAT
GATGACCGGATGACTCaCAGGGACGCTGGCAACTTTGAAAAGACCAAGCGTGCACTAACCCTtCTTGGACTGGAAAGCGATCGACAGCAAGCGCTCTTCC
GTACACTAGCTGGtGTACTTCACCTGGGGCAGAGCGTATTTGAAGCTGATAAGCAtAATGAAGATGCCAGTCGGGCAGATCGAAGCTCTCTTAtcGTTGC
CGGAGAACTGCTCGGCTTGGCACTCGCACCCATGGAGAAGGCTCTCTGCACGCGAACGATGAAGGCTGGAGGGGAAGTGTACGCTGTCCCACTCACTGTG
GCTCAAGCCAACTCGAGCAGAGATGCGCTTGCAAAGGCTATCTACGCGAACATCTTCACGTGGATGGTTGAGCAGATCAACCGAAGTCTAAGTGCGAATG
ATTCTGATGTTGACCACACGATCGGGGTGCTTGACATTTTTGGCTTCGAGAGTTTTGTGCACAATtCCTTCGAGCAGCTGTGTATAAACTACGCGAATGA
AAAGCTCCAACAGAAGTTCACTCAGGATGTCTTTAAAGGTGTCCAAGAAGAGTACGAGGCCGAGAACATTACGTGGGACCACAtCTCGTACGCGGATAAC
TCGGACATTTTGGCTCTCATCGAAGGCAAGCTCGGCATTATCGCTCTACTCAACGAAGAAATTGTTCGACCAAAGGGAAaTGATGAAGGCTTCGTCAGCA
AGCTCCAGACCTCATTCCGGCAACAGAAAAAGATCATCGAATTCCCTCGAATCTCACGGACCCAGTTCTCAGTCCACCATTACGCTGATACCGTCAAGTA
TGAAGCAGTTGGTTTTCTCGAGAAACACAAGGATGCATTGCTCCCAGATCTGTCGGAACTCATGCGTGGAAGTTCGGAGtCCTTCGTTCAAAAGTTGTTT
GAAGAGAAGAAGTCAGACGCTCCAGATGCACCAGACCCGAGGGCCTCAtCAGGGCGAGCCCGGCGATTTGGAGGACCAGGTGGAGCCGGTGGCAGTGCTG
ACTCGCagACGGTCGGCACACAATTTAAGCAATCTCTCAATCGCCTGATGGACAACATCAACAAGACAAATGTGCACTATATCCGATGTATCAAGCCAAA
CAGTGAGAAAAGTACAACTAAAGTCGAtGAGCAAATGGTCGTGAACCAACTGCGGTGTGCAGGAGTCATCGAAGCGATTCATCTCGCTCGAGCAGGATAC
CCCAACCGAATGAAGCATGAAGAGTTTGTCCGTGAATTCGATATTTTCCTCACTGgTGCTCAACGAAAGAGAGTCGGGGATGAGCGAAAGCTGTGTGTTG
TTCTAGCGAAGGATTTTGAATTGAAGACTCCTGAAGAATACCAAATGGGGAAGACCAAGATCTACCTTCAGCTCGGAGTGCTTGACCGACTTGAAGCATT
GAAAGCCGA