Description :
From Genome Similarity Track
Location :
Scaffold_1246:6185- 7664
Transcript NameFunction/comments
Phyag_g10036hypothetical protein PHYSODRAFT_329915
Phyag_g10037hypothetical protein PHYSODRAFT_354439
Phyag_g10038hypothetical protein PHYSODRAFT_350857

Sequence
1479 bases(100 bases per row)
GACTTGGCGTCTTTGTTAGAATGAGCTCATTGCCAAGCAGTATTCGCCTTCTGTACCCCCGGCGACGCATTGCGTCCCTAGCGACAGCTCGATCCTCGAA
TGGCTGCTTCGGTCCAACAATTCAGATGAAGGTCCATGGCCCAAACATGTTGCGGAGCCTCAACTGTTCCCTAATACGGTCATGCCTTACTTTGAAACCA
CGGACGAACCATGCCATGGTGTGGAAGCAGATATCACACCAGCGTTGATCCCTACCCCAGTTTCGACTACAACTACAACCCATTCGGACGTGTGCGCCAA
CGAGACGACGACCCCTTCGCTACCATTTGGCGACATTTGAGCTGTTCTCACCCGCTCGTGTatgtgctgtgctgtgctgtatCGAGACCTTAGGTACTGC
CTCATTTTCGCTTCCGACCGATAACTCAGTCTGCTTGAAAATACAATTGCGGCCCGTTTGACGCGTGGTTCCGCCTCTTCATTTTGTCCCTTTACTCTTt
gggctgttgctgctgcgtgggtGTGGCGTTGATTCCTGTCTCTAAGAAGTGGCGGAAGTCGCCCACCACTTGGGCCATGTGGCCTGCTGTCTGGATCTGG
CGGTGCAGATCCACGTTCTTGGGGCTTTTCTCCAtcaggttcagcagcttttccTTTCGTCGCAGCTacaaaagcagcaacaaggccAAATAGCACAAAT
TAGTGACTCTCGTGTCAAGTCCAAAGCAGCAATATCGGCCAGCGTCGTACTATTTCCTTGTAGAGCTCGTCGCACACCGAGTTGAactgctcgagcttct
tgacgacctGGTCCTCCACGTTTGTctggccttctccttctctgtTGGCGATACACATTACACATTATATCGTTAGAGCTCGCGAACTGCAGACCTGTTC
AGTAGCTGTAGCGTACGGGGACTGCTCCTCAGACTGCACGAGCGTCAGACACTCGGACACGAGCTCCTGTAAACGTCACAAAGTGTCGTCAGTTGGCCAC
AGATGGACACAGAACTCACGGACAACGCAGCACACACGTCGAACTTGGCGCATACGTCCTCCACACGCAGCGCGAAGGGTTTGTTGGGGTCCTTGGCCGC
CTCACTCGTCAGCATCACATTCGCCATGGCTGCTCCACCTTGTTCAATTAGGAAATGGCTCAAAACTCACCAATTGGTCAGAATATTTGCTTTATTTCCA
CCAATCAGAAATCGCTGCTTTATTCCCCCTTGCTCACACAGAGGAAGTCCAGAGGAGTAACGTAAGTAGTCTAGGGCAGTCATGGCCGGCCAACGCAAGC
TCCTGAGCGAGATCGACcgcacgctcaagaaggtAAGCGAGGGCGTGGACGTGTTCAATGATATCTGGGACAAAGTGTACGCGGCCACAGCGCAGAacca
gaaggagaagcacgaGGCGgacctgaagaaggagatcaagaagctgcagcggttCCGAGACCAGATCAAGACGTGGATC