Description :
From Genome Similarity Track
Location :
Scaffold_688:6184- 12941
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.4Glycosyltransferase
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.7ATP-dependent chaperone ClpB

Sequence
6757 bases(100 bases per row)
GGAATGGTGCGTTTGCCGGCTTGTTTGGTTGGATGATCTACGAGCCGCTGCACTTGGAGAAAGATACTGAGCTTCTGGACAAGGCCCAAGTGGCGGCGAT
GGCATTTGTGACTCCTGGAGCCCTCGTTCTGCTTGCGCAAGCGTTTGTGCCCCACCTCGTCACGAAGACTTTTGCGGCGAAATTCATTCGTGAAGGAGAA
ACCTGCTACGTGGGACGACACATGGCGCCGCCGCTCTACTACCAGTTCAAGTACATCACCTTCTGGCTAATCCTGTGGGCGCTGAAGGCGTTCATCTCGT
ACTTCATTTTGGTTCGTCCGTTGATGCTCCCATCGCTGGCTATCTACTCGATGACTCTGAAGTACAGCAGCAACGTCGTCTCGTTCCACAACCTCGCGTA
CATTTCAGCGTTATGGATGCCTGTGGTGTTCATCTTCAACTACGACACGCAGATTTACTTCACGGTGTTTCAGGCGCTTCTCGGAGGTTTTCAGGGTCTG
CTGATGAAGACTGGCGAGATCCACGGCATTCACGAGATCACCAAGGCATTCCGTGTGGCTCCCCGACTGTTTGACCAGAAGGTTGTTACCTCGCTCGCGC
GCTCCAATGATGCTGCCAACGACGGCTCTGCTGCTGCGTACCAGTCTCAGATGATGCTGCGCTTCGTTGTCGTCTGGAACGAGATCGTGAACTCTTTCCG
TGAAGGCGATTTAGTCGACGACAAGGAAGCCGCTATTCTGCAGTACGACATCCAAAGCTCGGGTGAAGTGTTTGAGCCTGTATTTTTGTCTGCTGGCAAG
CTCGCAGAGGCACTCGAGTACACTGTGCGTCTCGCGAAGGAAGGAAAGGGCGATTCGCAGCTCCAGGTGTACATGATGAAGAAGGACTGCTTGTCTGCTG
TCCGAAGCTTTTTCACTGCGTGCATGTACGTGATGGAGGCTCTGCTCGGAAGCGACGACGCAGATGTGCTGGATGCTCTTCGCACCATCGAAGATATTGC
CAGCGGCGGGAATTTCATGAAGACTTTCGACGCGAAGAGCTTGACGCAGCTTCGCTCTGTCACCATGGAGTTTTTGGAAGCGGTGATGGATCTTCCTGAC
CCTGACACGCAGTCGTCGCACTTGAGCTCTTCGCGAGTTCACACGATGGGCGTTGTCCGCAATTTTGTAACCAAGATGGAGAACCTCCTGAACGCGATTC
GTATTTTTGCCAATCGTCCAGAGCTTGCGTCGAAGTTCGGGAACTCGAAATTCTGCTCGAGTGCGAATGGATACGTGTACGCTTCTCGTGGTCTGGTGAA
CCTGTTCCACAACGACACTGCGATGGGTGCGGCCACTCGCGCATACCTGTTGATGTCGCTCGACCGAAACGACGCGATGCCACGCGTCCCGGAAGCGCAG
CGTCGTCTCGGTTTCTTCATGAAGTCGTTGGTGATGGAGATTCCGCAGCTGCAGGCGATCAAGGAGATGCGCTCGTTCTCTGTCGTGACCCCGTTCTACA
GTGAAAGTGTGCTGAACTCGTTGTCCGAGCTGAACAAACCTCTGGTTAACCACCCGATCTTCAAGAAAGTCGAAGAAAGTGGCAAGAACATCACAATTCT
GAAGTACCTGATCACCATCCATCCAGAAGAATGGGAAAATTTCTTGGAGCGCGTGGACGTGAACACTGTCGAGGAGGCTCAAGCGAACTACCCGATGGAG
ATCCGTCTGTGGGCTTCCTACCGTGGTCAAACGCTTGCGCGTACGGTTCAGGGTATGATGCTCTACGAAGACGCGATCAAAATCCTCCACTGGCTCGAGA
TTGGTTCTAGTCCCGGCAAAACGGCTGAGCAGAAACAAGCGCAGCTGGAAGATATGGTGCGCTTGAAATTCTCGTACATCTGTGCGTGTCAAGTGTACGG
TAAGCACCGAGCTGAAGGCAAAGAGCAGGCTGACGACATCGACTATCTCCTCAAGACCTACCCAAACCTTCGCGTTGCCTACGTGGACACGATTAATCAA
GACGGCGGCAAGCGATTCGATACGGTGCTGATCAAGAGTGAAAACAACGAGATCGCGGAAGTGTACCGCTACGAGCTGCCAGGTGACCCGATTATTGGCG
AAGGTAAGCCAGAGAACCAGAATAACGCTTTGCCGTTTACTCGCGGTGAATACCTGCAAACCATCGATATGAACCAGCAGCACTACTTTGAGGAGTGTCT
CAAGATGCCGCAACTGCTTGTGACTGCTGACCTGCACCCGTCGAAGAAACCTGTCTCCATCATCGGTATGCGTGAGCACATTTTCACGGGTAACGCTTCT
TCTCTCTCGAAGTTCAAGTCGTGGCAAGAGTTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTTGCGGACCCTCTGTACGTTCGTATGCATTACGGTCACC
CCGATATTTTCGACAAGGTGATTGCGCTGTCCCGCGGCGGTGTGTCCAAGGCGAGTAAGAGTATCAACTTGTCGGAAGATGTGTTTGCTGGTTTCAACTC
TACTCTTCGTGGAGGCGTTGTCACGCACGTGGAGTTCATGCAGTGCGGCAAGGGTCGTGATGTGGCGCTCTCGCAGATTTCTATGTTCGAAGCGAAGCTG
GCAAACGGCGCTGGTGAAACCTCTCTTGCGCGTGAAGCTCATCGTATGGGTCAATTCATGGACTTCTTCCGTCTGAACTCGATGTTCTACTCGCACACGG
GCTTCTACTACGCAACGTGGATGACGATCGTGACTGCGTTCGTGTACATGTACTGCAAAGTATACATGGCGCTGTCCGGTGTGCAACCGGAGATCATCGC
CCAAATGAACTCGACGGCGATTATCAATAGCAACATCGGTGGAGGCTTCGACGAGCGAGTGCTGACGGATTTGAAGGCTGTGGTGAACACGCAGTTCTAC
ATTCAAGCCGGTCTTTTCCTGATGCTTCCACTGATGTGTGTGTACTTTGGTGAAGGTGGTTTGGTGCGCGGCATGTACCGATTTGTTGAAATGATCATCA
CACTCGGACCGGCATTCTTCGTCTTCCAGGTCGGCACGACGATGCATTACTTCGACAACAACATCTTGCACGGCGGTGCCAAGTACCAAGCTACTGGTCG
TGGTTTCAAGATCACGCGAGAAACACTGGTGCTGCTGTATAAAGCATATGCAAGCTCCCATTATCGGAAAGCTTTTGAGTTGGTGGGCTTGTGTCTCGTG
TACTTGGTGTTCGGCAATTTCGCCATCGGGCAAACGGATGCACCAATCGGAGACGACGTTTTCGCAATCAGGTTCCGCAAGACAGCGCAAGGCTACGGCG
TGCAGACATTCTCGATTTGGTTCATTTCGATTCTGTGGATCGTCGGACCATTCATGTTCAACACCGACGGTTTGGACTGGGAGAAGACGAAAGTGGACAT
TGCTGCGTGGGCGAACTGGATGTTCGTTGACGAAAGCTACAAGGACGACGATCCAGTGAACACGGGCGGGTGGGTGACCTGGTGGAAAGGAGATCTGAAG
CAGCTCCACCAGTCCAACATGATCTCGCGCGTGACGGTGCTGCTTCGCGAGAGTCGCCATTTCATCCTGATGTTCTACGTGTCGACGATGATAACCTCGG
ACGTGATGTACGTTGCGTACGCGTTTGGTGCTGCCGTGGCTACCGTCGTGCTGCTGGGATTCGTTCACGGCATCGGCTTGGGAATGAAGTCTGTTCGTCC
GATGATCCGTGCGACGATCTACTTGACGTGCGTCTTGAGCGTGGTAGTTGGATACTTCCTGGCAATGTGGATTGTCTTCGACAAGAACTTCAAGTACTCC
GTTTCGCTCTTCTTTGGCTACGCTGCGGGGCTCTACGGCATCAACGAAGTGATGCGAATGTGGAGTTTCCCGAGCTCGTCGATCGCAGGTGTGGCCGTGT
TCCAGCAGCTTCAGTTCCTGTTTGACTTTTTGTTCTGCACGGCGATGATCATCCCGCTGTTCATCATGTCGTGTGTGCCGTTCCTCAACGTGATCCAGAC
GCGTATGATGTACAACGAAGGCTTCTCCAAGGTGATGTCTGGCTCGTCGCAGTATGCGTTCTCTCTGGCGACGTTCATGGGCATTCTCGGTGGCACTGGC
TGCGGCTGGCTGTTCAGTTTGCTCTCGACTTTGGAGCAGTCTCCAAGCTTCTCAAGTTACGTGAAGTCGTACGAAGACATCCTCAGCAGCGACCTCGGCG
ATGGCAAGATCACATTTTTGACATACGGCGCATGCACGCTTGGCACGGTGATGTCTGGTTTCTTGACCTACTTCATCGGACGTCGTCTGGCAATTGTGAC
GGGTGGTCTGTTCAGCACGCTCGGCATGGTGGCTGTCTGCGCCGACGGCGACCTTCGCAAGACGTTGCTGCTTCCAGGTATCGGTTTGCTGGGATGCTCG
ATTGGTATCCTCCTCCCGTCGCTCGCTGTGTATATCTTTGAGATTTCGACTAAGGACATGCGCGGCAAGTCCGTGCTGCTCCTCGGTGTGGGTTTCGTGA
TCGGCACGCTCATGAACGGCTACTTCTCGACGGTGAACGAACTCGGCTGGATGTGGCAAGCGTTCGGTGCGTCTGTGATGATTGCGTTCATCACGCCAGC
GGTGAACATCTTCCCAGAGAGTCCGCACTGGATTTTGGAGCGCAAGGGCTGGGAGGCGTGTGAGGCGTGTCTCGTGATCCTGCGTCGTAAGCCGGACGTG
TCGGAAGAGCTCAAGAGCATTCGCGAAGAAGAAGCGGGCGACGACCAGAGCGGCGGCGGTGCGTTCAAGTTCATGCTTGGCGTGTTCTTGATGCTGGTGT
CGTCGCTGTCCACTTGCGTGCTGAACGCGTTTGTGGTCTCCGAAGTGACGTCTTCGACGATTCTGAAGGACGAGCCGCGCATGTTTGTGAACTCGGTGGC
GCTGCAGCTCACTGGCTCGCTGCTGTCGTTCTTCTTCATCGATAAGCTCGACCACAAGTCGATCCTGTTCGGCACGCTTGTCCCCGTGGCGCTTTGTGCG
GGAGTGCTGGGCTTCAACGAGAACTCGGGCTTCTTGAACGACCTTGACAACGCGGGTTTGTACTACTCGATGATCTGCATGCTCATGTACTTCTTCCTGG
GTCTCGGCACGACCGCGGCGCTGTGGACGGCATGCATCGGGATGTTCAACACGCGCGGGCGCGCCGCGTCGACGACGTTCCTGTTCGCGCTCTTCTTCGT
GGCGCCGATGGGTTACGTGTTCATGCAGACCGATGTGGACCTGACGAAGAAGCGGTATGTGTACCTGTTTGCGCTCGCCGCATTCTGCGTCGTGGCGATA
GTGCTGCTAGTCGGCGCGGGCACAAAGAAGAACGGCGTGATTTGCACCAAGCGCGAGGCTGAAATCGACCGCGAGAAGGCGCAGCGCCACCGTGCAGCGA
GCCGCAACACGCTGCGCACACCCGGCAGTGCGCGCAACCGCAACCTCAGTCGCGCGCGAGCAAAGTCGAACGCCCCCGCGAATGCGAACGGTGGCCGCAA
CTACCAGATGTACGAGTCCCCCGGCGGCGCTCCCCCGCCGCTCAACGGCAACATGCATGCGTAGACCGACTGAGAAGACAGACAGTCGAGACTTTCTCCA
TATTTTGTGTGTATGTGCAAACCCTTGATCAAGTGATAAGGAAGATCAATAAAGAGAACGATGAAGACATTCATGTAGATGCTAAGCGTGTGTGAATCCT
GACAGCAACTCAGACAATCCCACCGTGCGGTACGCACACACCTAGCAAGTGCGAAACGGTGGCCCACATATCAGTCACATCACGTATGCGGAACTTGGTT
GGTTCCCAGCAGAAGATCTGCGGGGGCTCCTGCGCCACCTACATAGTCTCTCACTCATTCTCAAACGCGCACTCTACCACGCAGCACACTCGACCTCCAA
GCGCGATTCTCAAGATCTACTTTGGGAAAAAGACAATGGTACTCTACTTCCTGGAAGCTCTGCGTTGCTCTAGCCCTCGCCACTACCACGTCCGCCACCA
CCACCTCGCGTGGACAACGGCTTCTAGGAGAACATGTTCGGCACGCGCGGCTTGGTGCGAACCCACTGCGGCCTTGACGGTACGGGCGTCAAGTTCGTGA
AGCCAACCAACCTCGCGGCTTACTTCACACCCTGGTCGTTCTCGGGCGGCTACGACAGGTTCTACGCCGCCTTGCCTCGGTGCTGCGTCTCGAAGAGCTC
CCAACATTCGCTCGCGGTGCTACACGGGACCTGAAGATATACGTGGTTGGGAGGACTGTGCCCGACTGAACCACTAACGAGTAGGAGGGACTATTATGAA
CTCCGTTGTCTTTGCATCCATCACAAGCATCATTGCAAAATAATAACGCCGCACGTCAATTTGATGCAAATAGTTCTCTTTGGCCTCTTAACTCAATGCT
ACTGTCTCTCATCTTCCTCCCTACACTCAACTGATAAAATCACCTGCCTTCTCACTCGACGATAAGCGGCTTGGCGCGGCGCGGCTCCGTTAGTAGCTCT
TCGTCGTAGCGCGGGTTCATCTTCACGCGCACCGTGTGACCGGATCCGATCGACCCTTCGAGCAGCTTGATCGCCAGCGGGTTGAGCAACTCGTGCTGGA
TCAGGCGCTTGAGCGGCCGCGCGCCGTAGAGCGGACTGTAGCCCGTGGCCGCGAGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
TTGGATCTCCTTCTCCTCCAGCAGCTGGTCTACCTGGTGCAGCTGCAGATCGACGAT