Description :
From Genome Similarity Track
Location :
contig_8:618326- 619847
Transcript NameFunction/comments
g2055.t1hypothetical protein

Sequence
1521 bases(100 bases per row)
ACTTGACCACGACGTTCGAGTTCAGCCACCATCCGCGATAGACCTTGCCAAACGAACCAAACTGAATGGGTCTTTCTCTTTCCGGATCTCACGACTAGGA
AGGAACCACTCTGGTTTCTTACGAGCGACGGGAGCGCTCAAAAATGCCACACCGGTGTTCGAGGAATCGCCACTTCCTTTATCAACGGGGTGCTCGAGGA
GATAATCCACAATCACACGTTCAGCATCGATGCGGTTGTTCATCCGAGCGTAGTCGGAGGCGGTACGGTTTGCGTTGTCTGCCTTAGCGGTATTCGCGTT
ATTTTCAAGAAGCACACGCAAGATGTGCTCGTGGCCTCGGTACGCAGCTTTCATTAGTGCGGTCTGGCCGCTCTCGTCGGTTGCTTCAATAGCCGCACCG
TGGTTTAGTAAAGTTTCAACCACTGCGTGGTGCCCGTCCTCTGCAGCAAGCAACAACGCGTCCGTCCGCTATTCTCTGTCGCATCCACATTGGCATTGCT
CTCGACGAGCAGCTTTACAAACTCCTCATTCCCTGCTTGCGCTGATGCCATCAAAGGCGTGAATTCAGCATTATTTGGCAAATTCGGGTCGGCTCCATAT
TTCAAGAGAGCTCGCGCACAGTCCAGCTGCTTCTCGTAGATGCACTCGTGCAGAGCTGTGTCTCCATCATTGTCTTGGGCATCAACACTCGCCTGGTTAG
TGAGCAGCAGTTCGATCATGTCAACATGACCAGAATCTACAGCTACCAGCAGTGGAGGGCAATTGTTGCTATCTCCAAGACTGACATCGGCTCCATGCTC
CAGCAGCAAACGGATGACTTCCACGTGGCCATTCAAGGCGGCGATTGTCGTGGCTCTCTCTCCTTTCACGGCCTGAACATTCACTGTAGCTCCGTGCTGA
AGCAAAAGCTCGACGATCGTCGCGTAGCCCTCTTGTGCTGCACACATCAAAGGCGTATACCCATCCGTGTGCGCTAGATCAATTGCAGCACCACCCTCGA
CAACAGCACGAGTTGCTTCGAAGCGACCAAGAAACGCCGCCTGGATTAAAGCAGTGTCTCCATTCGCAGTTCGATAGTCGACCGCAGCCATGCTCTCAAC
CAGGAATTTTACGACATGGTGTGGCCTCTTTCAGCAGCAAGAATCAGCGGTGTGGTTCCTTCGGTATTGGCCACATCAACCCCAGCTCCACTATCAATGA
GAAGGCGAACAATATCCAGATAGCCTTCTTTTGTCGCACAGATCAAAGGCGTGAACCCTTCACCATCAGCTAGCTCCGCATCTGCCCCACTTTCAATCAA
TACCCTGGCGATTTCCAAGTGTCCTTTGTTAGCTGCTCGAGTGAGTGCCGTGTCCCCATTACCCGCCTGAGCATTGACCACAACATTCTTCTGGATCAAC
ATCCGAACAGCGTCCAATTGTCCACACGAGGCTGCTCGAATGAGCGGCGTGTCCCCATTTCCACCCTTCAACTCAATATCGGCCGCACCATCTACCAACA
CTAGAACAATTTTCATACGAC