Description :
From Genome Similarity Track
Location :
contig_8:618324- 619957
Transcript NameFunction/comments
g1916.t1hypothetical protein

Sequence
1633 bases(100 bases per row)
GACCACGACGTTCGAGTTCAGCCACCATCCGCGATAGACCTTGCCAAACGAACCAAACTGAATGGGTCTTTCTCTTTCCGGATCTCACGACTAGGAAGGA
ACCACTCTGGTTTCTTACGAGCGACGGGAGCGCTCAAAAGTGCCACACCGGTATTCGAGGAATCGCCACTTCCTTTATCAACGGGGTGCTCGAGGAGATA
ATCCACAATCACACGTTCAGCATCGATGCGGTTGTTCATCCGAGCGTAGTCGGAGGCGGTACGGTTTGCGTTGTCTGTCTTAGCGGTATTCGCGTTATTT
TCAAGAAGCACACGCAAGATGTGCTCGTGGCCTCGGTACGCAGCTTTCATTAGTGCGGTCTGGCCGCTCTCGTCGGTTGCTTCAATAGCCGCACCGTGGT
TTAGTAAAGTTTCAACCACTGCGTGGTGCCCGTCCTCTGCAGCAAGCAACAACGCGTCCGCCCGCTATTCTCTGTCGCATCCACATTGGCATTGCTCTCG
ACGAGCAGCTTCACAAACTCCTCATTCCCTGCTTGCGCTGATGCCATCAAAGGCGTGAATTCAGCATTATTTGGCGAATTCGGGTCGGCTCCATATTTCA
AGAGAGCTCGCGCACAGTCCAGCTGCTTCTCGTAGATGCATTCGTGCAGAGCTGTGTCTCCATCATTGTCTTGGGCATCAACACTCGCCTGGTTAGTGAG
CAGCAGTTCGATCATGTCAACATGACCAGAATCTACAGCTACCAGCAGTGGAGGGCAATTGTTGCTATCTCCAAGACTGACATCGGCTCCATGCTCCAGC
AGCAAACGGATGACTTCCACGTGGCCATTCAAGGCGGCGATTGTCGTGGCTCTCTCTCCTTTCACGGCCTGAACATTCACTGTAGCTCCGTGCTGAAGCA
AAAGCTCGACGATCGTCGCGTAGCCCTCTTGTGCTGCACACATCAAAGGCGTATACCCATCCGTGTGCGCTAGATCAATAGCAGCACCACCCTCGACAAG
AGCACGAGTTGCTTCGAAGCGACCAAGAAACGCCGCCTGGATTAAAGCAGTGTCTCCATTCGCAGTTCGATAGTCGACCGCAGCCATGCTCTCAACCAGG
AATTTTACGACATGGTGTGGCCTCTTTCAGCAGCAAGAATCAGCGGTGTGGTTCCTTCGGTATTGGCCACATCAACCCCAGCTCCACTATCAATGAGAAG
GCGAACAATATCCAGATAGCCTTCTTTTGTCGCACAGATCAAAGGCGTGAACCCTTCACCATCAGCTAGCTCCGCATCTGCCCCACTTTCAATCAATACC
CTGGCGATTTCCAAGTGTCCTTTGTTAGCTGCTCGAGTGAGTGCCGTGTCCCCATTACCCGCCTGAGCATTGACCACAACATTCTTCTGGATCAACATCC
GAACAGCGTCCAATTGTCCACACGAGGCTGCTCGAATGAGCGGCGTGTCCCCATTTCCACCCTTCAACTCAATATCGGCCGCACCATCTACCAACACTAG
AACAATTTTCATACGACCTTCTTGAGCTGCCACGAGGAGAGCCGTGTCCCCATTACCACGAGCGAGGTCCGCATTGGCCCCGCTTTCCATCAACAGCTTG
ACCACCTCCAAATGTCCTAGTTCAGCTGCACAA