Description :
From Genome Similarity Track
Location :
Scaffold_845:6182- 8003
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_845-snap-gene-0.8Myosin

Sequence
1821 bases(100 bases per row)
GTTAAACGTCGCCTGCAGCGCTTCGTTCGCAAAGTTAATCAGCAGCTGCTCAAAGTCGTTTTCCTCGAAGGACTCGAAGCCGAAGATGTCGAGCACGCCA
ATGAATGGCAGCGAGCTGTCTCCGTGGCCGAGTGACTTGTTGATCTTGTTGACGATCCAGCGGAAGAGGAGGTTGTACATGGACTTGGCGATCGCGTCGC
GCACGTAGCCGCCTTCCTTGGCCGAGCGGCGGATCGTGAACGTCTCATCGCGCGTCGAGATCTCGCGCTCCGTGATCACGCGCGTGAGGCCAGCGCTGTC
GACGCCGAGCATTGCAGCACAGGCGTTCAGGTATCGCTCGCCGTCTTTCGCAACTTCGGCCACGTCGCCCTCGGCCGTCTCGCGGTCCTTCAAACGGATG
TTGCCCAGGTGCAGGAGACCCGCGAGGATCTTCCAGACCTCCTTCTGCATCGTCGGGTCGATCCCAACGGTGTTTAACGCGCTCGTGACCTCGTCGAAGA
GCAACTCGTCGTCGACGTTCGGGTCCGTGAAGCAGCCACTCTGGTTGAGGTAGTCGAACTTTTGCGCGGGCTCGAGCTGGAGCTCGGCCGCGAGCGTGTC
GTTCGCGCCCGAGAGCAGAAAGTAGAAGATGTGGAAGTTGCGCTCGCCCGGAATCTGCGCTACGACGCGGAACTTCTCCAGCAGGTACGTCTCGATGAAC
GCGCCGAAGAGCGTGTTCGTCTCGGGCTGGAACTGGAGCTTCATGAACTTGCCGAAGCGTGACGAGTTGTGGTTGCGCAGCGTCTTGGCGTTGCCAAAGG
CCTCGAGGATCGGGTTGGTGTCCCAGAGGCGCTTGTCGAGCTCGATCGCGAGCTTCTGCGACTCGCCCGCGATGCCCTTGGTCTTTGTGGCCAGGTGCTC
ACGGGACGTGAGGTAGCGCAGCACGATCTTGGACGTCTCGGTCTTACCGGCGCCCGACTCGCCCGAGATCACGATCGACTGGCAGTGCGCGGGCGTGCGC
AGCGCCATCTGCTGGAACGCGACCTCGGCGATCGCGTATGGGTGCGGCGCACGCTCGCCCATCTGCGTCTTGATGTAGTCCTCAACCTTGGGCTCCACGA
CGCGCACGAGCGGGTTCACGGCGATGAGCACGTTGGCCATGAGCGTATACGGGCGCAGGTTGTCCGTCTTGGAGCGCGCGTACAGGTTCTCGAGGATGCC
GGCTTCGTGGATGTAGTAGAGGCCCGTCATGTCGTCCACGACGCGCGGGTTGACCTTGTACACGTCGCCAATGTCGCGCAGGTCGAGCGTCTCCTGGCCG
AACTTGCCGTTGACCGAGAGCACCACGTTGCCTTTGTCGCCGTCGGCGTCGATCTTGGCGACCTCGACGATGCGCCAGACGCGCTCCGGGTCCGGGATCC
AGATCTGCGCGCCAACCTCGACGGGCGCCTGCGCGAGCGCCGAGACTACTTCCATGGTGCTGCGGCGGCGCAGGCTGTTGGCGGCGCGTTTCTTGTTCTC
GAGCACGAGCCGCTGCGCGATGCTCAGGTTGGACACATCCACGGGCGCGGCGCGGTGCGGCTGGAACCGGTCGTACGTCGGCAGCGCGCTCGACGGCGCG
ACGGCCACGCGCGGCTTGGACATCTTCGCTCTTCTCTTCTCTTCTCTTGGGCTTGCGATGGGACCTGGGGGGCGGACGTCGACTTCCCTACTGACTGACT
GTGTCGTGGAGAGCCCTGGTGTGGGTCGTAAACAGACAGACACACGGAGGAGAGGCACGTGGCGATCTCTCTCTGCTCTTGCTCTGCGTACCTCTTCTCT
TGTGACGTACGACACAGAATG