Description :
From Genome Similarity Track
Location :
Scaffold_127:61818- 63163
Transcript NameFunction/comments
Aphas_H257_17978myosinlike protein putative

Sequence
1345 bases(100 bases per row)
GCAGCGTATCCTTGTTCTTATCACAGAAGCCGAATGTGTGATACGAGACCCATCCTGCGTAGTGGTGGATGGCAAACATGTGGTTGGCGCGATCGGCATG
GCTCGCCCGAAAGAAGCTCGACGGACACGCCAGATCTAGGGTCTTGGTGGTGTGCCGTTTGGTGGCTTTTCGGGCAAAGTTTTCGTCGCTGCCTTGGGGC
ACGATGCATTCTTCGTCTAGCATGTGGAACAACCCCATGGGTTTCTTCTCGAGCAAGTCCAGGCACGGCTGGTTATCGGGGAAGTTGATAAAGCTCCACT
GAATGCGCTCCCGTTCATATGTGACTTGCTCTTGGCGAAGCACAGTTGCATTGAAGTGATGCTGCAGGGTTTCATTCGCATAGTTGATACACAGCTGCTC
AAACGAGTTGGTTGACAGGTCTTCGAACCCAAAGATGTCGAGCACGCCAATAAACCCCGCGAGGTCGCCGTCGCCGTCGTGGTCGATCGTACTGTTGATG
CGACCCACGAGGTACTCAAATAGCTTCCCATATACGTACCTTGCCAGCGCATCTCGGTGTTGCTCTGCTACTTCGGGAAGAAGACCCAGCGTATACCATT
CATCCCGCGCTTGGATTTTCCGCGTGGTGAGGGCCACCTCGAGCGCATGCCGGTCCACGCCAAAGAAGGCGGTTACATGGAGCTCCGCGGCGGCGCTCGT
CGGGTCACTCGACGCCAGCATGGACCCCTCTTCATGGTGTACGTTGTGGGGGGGGGCGTGGAATCTGAGGTTGCCAACATGGAGGACGTTTGCCAGCGTG
TACAAGACGTTGTGCTGGTCTTGGTCGTCAAACTGCATCGTGTCGAATGCTTCGCGTAGGCATTCAAATTGGTCCTTATCGCTCACGCCGTCCTTGCGCA
CGACGCAGTCGCTTTGGTTGAGGTAGTAAAAGTACGCGGGGGGGTACGTTAAGCCCCATTTTGTTTTCCGATCGTCATCCAGCCCCGCCAAGAGTTCGTA
GAATACGTGGTAGTTGCGCTCCTTTGGGGCTTGGCTGGTCACTCGAACTGTTTCAAGGAGATATGTCTGGATGCCGGCGCCGATAAGCAGCCCCCGATGG
CTACTGAACTGCATCTGGATGAACTTGCCGAACCGACTCGAGTTGTCATTGCGGATCGTCCGCGCGTTCCCAAATGCTTCCAAGATCGGAGATGACGACA
GCACCTGGGACATGACGTCGCTCTGGTTGATGTTGATATTGCACATGCTTTGGCTTTGGGACACGGCCGCGAGGTACTTCATGATGAACTTGGTGGTCTC
GGTCTTGCCTGCGCCAGACTCGCCGCTCACGAGGATGCTCTGGTT