Description :
From Genome Similarity Track
Location :
Scaffold_40:618154- 620887
Sequence
2733 bases(100 bases per row)
CGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGA
CCTGGATCGTGGAACCAAATACTGCGTAACAAGGCAATAGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCA
GGGATGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCCCGTTCTGTGTCAGAAAGCCGAACGGCAAGTAGCGCATTGTTCATACTTTTAACAAGCTAA
ATACGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGA
TGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGG
CTGTCGAACGCACCAGCAGCGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAGACGTACTTTGACGATATATTCGTCCATA
GTCGTGCCGAGCACGGAAAGTCAGCCGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACCAATAAGTTGTATGCCAACTTGGA
CAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGAATGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGGCATCGTGGAC
TGGCCGGTTCTCTAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTTAGCCAATTACTTGCACAAGTACAGCGCGAGCTACGCGGAGATGACTCGGCC
ATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATC
CTTGCGATACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGCTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTG
AACGCGTGATTGCGTTTGACAGAGAAGAACTATCCAGTTCATGACAAAGCGCTACTGGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAG
GCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGCTACTCACTGCGCACAGTCGCCTCATCCCTCTCAGAGAATGGCAAGATGTCTGTCCTTCTTT
GCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCTCATGTCACGA
CAGTGACGTCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGACGACATGTGCGTAGCGCTACTACGGGCTCTTGGGAGCGAAGAGTTTAAAAA
CTCTGACAAGGAGCTGTCTGCGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGTGGCCTGCTGTACTACAGCACCGACTCTGAGGATAAATCT
CGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATG
GCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGGGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAA
CACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTAGCCTTCCCAAGGATAAGGCGGGAAAC
ACTGGTATAGTGGTCTTTGTAGACCGATAAAGCAAGATGGCTCATTTAGCGGCGGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAG
ACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAGTTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGG
CACTCGTTTGGACATGTCCACAGCGGGCCATCCGCAGACCGATGGTCAGACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCT
GAGGCGCCAAAACGCTGGAGCCAGACGCTCCCACTCGTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGA
CTTGGTTAACCCTCACGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCG
GTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGAGACGCTATGGCTGATAGCCAAGACACGCAGAAGGAACATG
CAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCCGTCTT
CAAGACGAAGTTAAGACCTCGGTTTATAGGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCAT
CCGGTCTTCTATGTTGGCTTGCTTAAGCCATAC