Description :
From Genome Similarity Track
Location :
Scaffold_491:618- 23825
Transcript NameFunction/comments
g15252.t1hypothetical protein
g15253.t1hypothetical protein
g15254.t1hypothetical protein
g15255.t1ETP00142.1 hypothetical protein F441_22436 [Phytophthora parasitica CJ01A1

Sequence
23207 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTGCGGGCTGTATCACCCCCGTAGGCAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
AACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCGTAAAGTAGCCCCCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCATCGAAGTCCAGTCTCGTATCCTCGGTTACTTCGGGTGCTAACCGACTCTT
CAGTCGGTCTCCGAACTCGCTGACGGCTTTGAGCCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCAATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGAGCGAGTTTCTTGGTCAACCCTGGCTTGAATCGTTCCATATACAACCAAACTC
TGCTCCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGATCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCGTCGGC
ATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCAC
GAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGG
ATTGTGCGTCCCATCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTC
CCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGTCGATAGCTC
AGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTC
CGAATCTTCGATACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTG
GAACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACGTTTCCT
GGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAAT
AGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGG
CACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACAAACTTG
TCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCTGCTCTTCATCCT
GGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACATCTTCTGCGTTCGGAGCGCGGGGGTCCGCCTCGTTGCTCGATTGCTC
GGCTCTCAGCTCGTTCGGAGCTTCGGTAGTCACACCATTCGCTTCGTCTCGTTCAGCCGCATCGTTCGGACTTATCGCCGAAGTTTCATCTGCAAACTGG
ACTCGTTTCTTCCTCGCTTCTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAATATCTGTCGCGGGAGATTCC
ACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCG
ACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGA
CCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAG
GGACTGCTGGATTGCGAGTCTCGAGTCTCCGACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCATTGTTCATTCCAGCATACTCA
GCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCATCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTACCCAC
CGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGT
AGGTGACCCTTTCGTCGGCGGTGTAACCGGGGCTAACGAGTCTTCCAATTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTGCAATCG
CGTTCCTTGACTCTGTTGACCACCAGGTGCCACGGGGACAACAAAACCGCAAAGTGGGTTGCTCGACCGAACAGTGTCTTAGATTTGTGCACCCATTCGA
GCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCAGG
ATGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCAC
TCATTCGCGAATAACGTGACATGCGCTTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGCT
TGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCATCCTTCAACTGATACAAAGCCGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATA
ATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCT
GCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTCGGAGCAGTC
GGTCTAGCGTCTCCAGGCACGCGTCAAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATC
CGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCGTTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGTC
AACCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAGA
AGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACG
AAGACATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAG
CAGAACCATAAGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGA
TGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAATGCCACTAGACGAGCTTTCAGCAAGCC
TTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACA
CCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAACACCGCAACGAGACTTTCTTGTTGACGGACTGTCGCGC
TCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAAGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTC
GATCTCATTCGCCAAATGTTCGGACGCATTGGTATCGGTGTTCTCACTACCTGAGCCGTCCCCCGTGGTAATCTCATGCATCATTGCTACGAAGGCAGAG
TCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGT
CGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTCGCACCGAAGTCGTCAACGGCATTCGGTCTCGTTCTGTCGGTTCCTCAGTGCT
CCTATCCGCGAACGTTATCTGGCCCTCGTCTAGGCCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACA
GCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCAT
CATACTTGGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAAT
CTTCGGTGACACGTTCGTTAGTCGCACCATTGTCGGCTGTCCCCGTCAAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCG
TGAGTAGTCAGAGGCGGTCGTCGTCGTGGTAACCTGAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTTGGTCGGGCGTCCAGTCACTTGCATGC
TGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCC
GGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCTACTCCTGCACTGTTGTCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTG
ACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACC
GTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAA
TCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATT
TTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCT
TTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTT
GGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGA
GGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTT
AAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACTATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCT
CGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAG
CAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTC
CTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGC
GTCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGT
CGGTCTCGGCGATAGCTGTCCCGCGGATCCTCGGAGCGCCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTC
CCGATTTTCGCTCTCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCG
GTCTTCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGG
TTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACG
CATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCA
TTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTG
ATGTTTCCGAGTGGGAGATGCGTGGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACCGCGCTCAACTCACGAATTTGGCGTGCCCATTCTCCCG
TCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCGTCGTGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCC
AGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATACGTC
GACGTCGCACCTTGGGCTGAAAATATTCCGGCCTCGGTCGACCCTCTGGGGCGTCTCCCAGGGGTCAGGCAATGGAATCATGGACGGGTCGACCGGATCC
GATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGT
CCTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTG
CCGAGTACTCCACGACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTG
CTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCG
CATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAG
GTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCT
TCGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAAC
CGGAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTT
CTTTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAG
GAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGAC
CAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGATGT
GACAGGCCTCTGTCATACGGGTGCCACCGCGTGTGCGCGGTGGCCAATCAGAGTCGAGCGTACAACCGTTGGTTGGGACGGTCTCGAGTCTCGATACTGC
ATGTCCACATCAATCAATTAGAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAGCACT
TTGTCGTCCGTTCAACGCCCAAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGGAAGC
ACTCCACCGCCTGGCAGCGGTGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAATGGAACACGAACAACGCTTGTGTGCTCAAGAGTTCTTA
ACGCGTGAGCTCGCTGATCTACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGCGGCG
AAGGCAAGACCCGCCTTCACCTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCTTCCT
GCTTTCCAAGTTGTCCGGGAAGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGACCTG
CGACTCGCGTTCGAGCCGCCCCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAACGCG
CGCGCCATCTCGCCTCGTGTATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCTTCTA
CTTGACCCGCAAGACGCCATCGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTCACGG
CCTCTTGTCCCTGACCCAGAGCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCCTCCA
CTCGGGGGTCGCGTCCTATGAAGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTACGAC
TGCGAACGACGTCGCCGCTCCAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAACCTC
CTCCTAGCCCTCCCGTGCTTCACGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCACAGCG
CCCAATACGCGCCCTGCTGGATTCCGGCGCGACGAACAACTTCGTTCGCGCCGCGAGTTTGTCGGCATTGCCGGCGGACATGAGCATCCGCGAGAGCGGC
GGTGAGATGATCGTAAAGTATGCTGACGGGAAGCCGCGGCGTACGCCACGGCGATCTGCCACCTTCGCGTACGAGTTTGACGGGTTCCGCGGCTCGGAGG
AGTTCTTGGTGATCGAGCTGAGTGGCTCCTTCGACTGCGTCTTCGGAATCCCGTGGCTCGCTCGCCACCAGCCTGCCATCGATTGGCTCGCTGGTACAGT
CCGCCCCCGCGATATCGACGTGAATGCCGTCGAAGCGTTCCTGTGCGGAACGCCAAACCAATGGCCGCATGTTACAGTCATGGACCCCGAATCCATGGCC
CATGCTGCACCCGAAGCGAGCGATGGCCCTTCATGTGCAGTATGCGAAAACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCGTCCGATGTGG
TCGAGCATGGGTTCCCACGTCCCGATGAGCAGTGGTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCT
CTCCCCCGAAGAAAAAGATGACGTGGTCGAGCATGGGTTCCCACGTCCGAGTGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTC
CCGCGGGTGGTCGAGCGAGAGCTCCCCGAAGAAGTTGACGCGGCCGAACAGCTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTG
CTGACGTGATCGAGCATGGGTTCTCACTGTCAGCTGTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCC
GTCGCGGGATCCAGTCGAAGCTGAGACCGAGATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGT
CCTCCATGCGACGCTGCCGAGATCACTCGACTGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGA
TCGTCGCCGAAGACGCCGCATCCATCGCAGCCGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAA
CGCCCGCGCAGCACGATACGCTGCCCAGTCGTTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCG
GACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTC
CCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTG
CGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATG
GTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTG
CCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCT
CCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACAC
CTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACG
TCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCT
CGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAG
CACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGA
GCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAA
TTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGAC
CACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACA
AGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTG
CGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGC
TCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAG
GCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGC
TCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGC
TCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGG
ACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGT
CACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCTCCGATCGCGATCCCCGCTTC
ACCGCCGCATTCTGGACCGAGCTCTTCAAGCTAGTGGGGACGCGGTTGAAGATGTCCACCGCGTCACACCCAGAGACGGACGGCCAGACCGAACGCGCAA
ACAGGGTCGTCGAGGACGTGCTGAGAAGCTTCGCCACGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTCTCAACAACGCCGTTCA
CACGTCGACCGGTCTCACGCCATTTTACGTCAACTACGGTCGCCATCCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATTCCCCAAGGCGGCGCT
GACGACGAGAACGACTCGGCGCACCTTTCCAATGCCGACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCTTGATGAACGGTGTCA
CGACTCGGCACGGTGCCCGAGCCTCAACTCGAGGCATGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCATCTTGGACACGTCGGACGCT
GATCAACCCACGTCAGCGTCCTCGTGCAATTGCATATGAAGACACGTCCGGCGCGGCGACCCCGCCCGCGCCGCCTCCAGCAAACTTTGACCCCATTCCG
TCCCCACAACCGCGCGACACAGCGGCTGTCAGCAAGTTCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTGCAGTGGCAGTCGATC
GTCAGAAGGAAAACGCTGATCGACGCGGCCGCAAGAACATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGGCATTCAACCCATTTT
GGTTACCAATTTGGGCGCGAACAAGCTCGCGCCAAGGTATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACGCTACAGCTACCTACA
GCGCTCCGGCTTCATCCTACTTTCTACGTCGGTCGGCTGCGGCGATACCATCCCGCGCTTATCCCCAGCGACGACGCTGCCACTCCCCAGCGTTCCGGTC
TTGGCCCCGCTGCGGCGATTGGCGCCGCGGCACTCGGCGACGCAGCTCCTGGTTCTCATTCTCCAGCACGTCCAGACGACGCGCCATCCGATCCAGACGC
TGCGCGATCGCAGCGTCCTATCCGCGATTCTCCGTTTGAGCGGGACGGCCCCGCTCCTCTCGTCGATGGTGCTGGTAATATTCGCCACGTGGTCGAGGCC
ATTCTCCAGCACGATGATGCCCGTGCTGCCCCTCGTTCCGGCCGTCGGAGTCGCGGTGGTCGTCACCGCGACAACCCCGTCCCCAGTCACCGCCAGTATC
TTGTTCGCTGGCTTGGCCCCATGCCGGATAGCTGGGAGCCCCGTGCGATCCTTCTTGCCGACATTCCGGACTGCGTGGCGGCGTACGAGGCAAGCCTTGG
AGAGGGGGCAAGTCCTCCGGACGGCGCGGCGCCACGCCGCGCCTAGACGCATGAAGCGAAGCTTCGAATCTTCCTATCAGTCGACGCTCGGACTCGGTGA
GCGGATACTCCTCAACCTGGCGCTGCCACTCTTCTGCACTCGGTCGCGGGAGATCGAACCCGCGACATCGTGGACATCCTGTCTTGAAGTGCACGAAGCA
GGATTTGCGGTCGGCGTCGTACGACGTCTCACAGATTTCGAGGGCCAGAGCACTGACGGACAAGCGCGAGTGCGTGGCCTCGCGCTGCTCGAGTCTCTGC
GTGAAGATCTCCTCACCCTCAATGTTCCAGCGCTCCACGAAGGACGTCCACGATCGGTCCATGGACCGATAGGTCACGGTGCCTCTCGCCGCGACGGGCT
TACTGCGAGTCGATCTCCATCGGTTGAACAACGCGATCATCTCGTCCGCACTCCGATCACCTTGCACGGCGCTGCAATCGTGCAGCGCCCACCGCTCCAG
TGTCTCTTCGTACGTGAGGTCTCCAGTGTCCATCGCAGCTCCAATTCTCGACTGACGAAGATCCAAGCTTCGCCTTCTCTGCGTGTTTCTTAGCCTGAAT
GGGGAATGGTGTGACAGGCCTCTGTCATACGGGTGCCACCGCGTGTGCGCGGTGGCCAATCAGAGTCGAGCGTACAACCGTTGGTTGGGACGGTCTCGAG
TCTCGATACTGCATGTCCACATCAATCAATTAGAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACA
AGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGGAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGG
TAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGTCACTCCTAT
ATATTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTA
GCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCAT
CATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAA
ATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGA
GACCCGCCAATCAAGACGCTCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACATCCAGCTCT
CTTTTTGCCATGGTTTGATGCGTGAGCTGATCTCAGGTGACGCTAGTATACCTAATCCGGCCGATTTTGTTGTTGTTTGGGTCCAGTAGCTCATTTCATG
GTCAGGGTTGGTGATCTGCCATGCTCGTTGCCATTGGTCCCTCATTTTTTGTATTTCTGGGTTGCTGTGTAATTGAGTGTCTTGGAGTAATATAATATCT
GGTCTTCGGTTGCCGCGGTGTCGTCGCCACCCGCTCATCCACTGTCTGCGTGATTTCTTCGCAAATCCCCGTAAGTTTTGTGTGCTGATGGTCAAGTTGG
TTCGTGGCTTCCGTTTGTTTCTGCTGGTTATTGGTGGCTGTTCAAATAAATTTGCTATGTTATGTAAATCACTGTAGTAATCTCCGTCTGGAGATTTGTT
GGTTCTTTGCGCATTCACTTGGTTTAGTGTTGTGGCTCTGGTTCGCTTTCCAGATCCACGGCGGTGTTATCCGAGTTTGTTCGCTGTGTTAATAATTCTT
CGAGTTTAGTCCATACTCCAATTGTATCATCTTGATGGATCGTGGAGTTGATGTCTGAATTAGACTGCATGACTTCAAAGAGTAAATCGAGATACTCGAT
CGTTGTTGTTTGGTGTTGGCATCCTGGTTTATTGGACAATCGTCTGAGTTCATTCACATATACATGGGCTACAATAATCATGCGAGTGAGGAATTTCAAT
CGACCCTTGCTGCAGAGTTTAAGTAGTTCCATGTCTCCATATTTCATCAATTTGAGTTCCCTCCAAAGTTCAGCTGGAAATAGGTTAAGTTGTTCCTGGT
TAATCGAAGCTTGTTGTTGGAGCTCAGTACTACATACCTCCAGCCATGTCCCTTGTTCTGTGTTCCCTTTTCCTTTCATTATTTCCGCAAGTTGTCCAAG
GCAGTGGGTAAGGCATTCTAATCTGGCTGTAGTGGTCCATGTGTCGAGAATCGCATCAGTCATCGTTGAGAGAATAAAATCAGGGGATTGGTAGGTCTGG
AGTGCTGAGAGAAGTGCCCCCGGTGCTTGTGTGACTGCTGGTTTCCAAGTTTCGGATGTTGCAGGTAGTATGGGAAATTTCGCTAGTGTCGCTTGTTCCC
AATTAATTGCCTGCTTCAACCACAGTTTCCGAAGTTCTTTTTGTCGTGTCCTGCTGGAGCTGATAGTAGCTGCTGGTTTATCAAACCTGCTTGGTTCTTG
GTTTTGAGGGCGGATAGTTGTACTGTCCAGTGGGTCTGGTAGTAGTTCTGGGTCGTCTTGTTCCCATGTTGATTCGTTCGACGGTGGTTCGCTCGATTGC
GTCGATGTGAAGGTTGATGATGGTCCTTGATCGAGCAGCTCCATTTGCCATTGCTTCAGTGTTGTTTGGTCTACCTCGTATCTTTTCATCCATTCATTCA
CTGCGGCTTCATCCGTCCACTGTAGCTCTCGTAAATCTTGTCTCCGTCCTGGTGCAATTCCATCAATTCCAGAAGTTGAGAATACTCGAAGTTCCTCTTC
ACGTCCTTGGCCGTAGATTTTCTCCTCATTGCGCTCCTGTGCCTCTGTTGCTGTCAATGGGGGTTTGGGCTCCTGGTTTGTTGATAGTGGCTCTGAAGGT
TTTTTTACTTCATTGTTTTCAGCCAGGTCCATTCCTTCGTCCTCTGAAGTGACTTCCATTGGTTCAGCGGTGTTGTGGATGTTAAGGTTGCTCTGTAGAG
AGGCTTTAGGGTTGAATTGAAGGTGGCTATAATGTTTTGGTCGGAATAGCAGTACTATGGGTAGTTCGTCCGGTGATTCTCTGTTCTTGCAGTCCTGTCG
AATCTGATTGATCCATTGTTGGGCTTGTTTTGCTTCGTAATTTCGTTCTTTGGCCGTACTGTACTTGTTTCCTGATTTGGTTACCTGCGCTGGCGTGAAT
TGCTGGTATGTGGCCTGGGCTAGCCCTGGTCTAGCTACGACCACAAATATGTTGCGGTGCAGGATCTTTGCTAACATTCGTAGTGTTTCATCAGTTCCCC
AGTGGCGTCCCGAAATGTATCCGCTTCGTCGTGAGTCTGACTTTCCCAGGTCAATGAAGTGTGTTTTCAGTGCTTGTTCGGATTGCTCCGGAGAAAGTTG
TTGTGGTGTTCGCTCCACTGCAGTTAAAATCTTGAGTCGTGAATCGTGTTCAAATTCTTCGTTGAAGAAGTGTTCGCTTGCTGCTACGAGGCCTTTCTTG
AGTTTACCAGTGATGGTTTCGAGTGGTTTTATGTTGTTCGTTTCTTTGAAGTTTCTGTTGAGTAGTGCAGATGCGACTGCATAGTATTGGCAGTTGCCAT
TGTCTGGTGTCGACGTCTCTTCCAATCCACATTCCTTAAGGACCTGCTGTCCTGTCATCGTTGTTTCATCACACTGGTCCAGGTTAAGACCAGCTATTTT
TTCTAGAGCTTGTTTGTTGGCTGGTTGTCTGCGCTCAGCAATGAGCTTGTTGATTAGGCCTCGTTGCGACTGCATTCGTTGAGTTCGTTGGCTTAATGTT
TCGCGGATAATTTCTGCTGGTGAAGTTTCCCTGGTTGGAGTGATCGGGTGAGGAGGGTACTCCATGTTATTTGCTATGGAATTGTTCTCGTCGCTGTGCT
CTGTCGCCAGCACTGGTCCTCTTTTTTCGTCTTGCTGTACATTAAAACGATGTCCCTTGTTAGTTCCTACCGTTTGCCATTCGTTCTTACCTGGTTCAGG
ATCTTTTGGCGTGATTGATGTACGTGATGCTGTTGCAGCTGTCGTGTGGGTCCTAGTAGATCGATTTTCAGTTGACAGTCGATTTAGCTGTGTCAGTGGG
AGCACTGGCATTTCTGGTTCTTGCTCTTCATCTATCCAGTACTTCGTCATTTCCTCAAAGCTGATGACAGTGCGCTGTTGTCTTGGTAGCGCTGTGATGT
CTTCTGCTGAAACTTGGATGCAGTACTCCGAAGTGTACCAGTAGTCATCCTGAGCGTTACATCTGTTGCGCGTGTGACCAATTGCACCACATTGGAAGCA
TGGAGGGGCTGGTTTCACGTTGACATGGTGAATTAGGATCTTTGTTCCATTCCAGTTCAGGAATCTGCGGTCTACTAGGAAAGTAGGACATAGTTGGCTC
TTGAAGTAGATATCCCAGGTATCAGTTTGCCTCTCGTGTGTTTCTGATGATGGTTCCTGCCACGTCGTGTACACACCTGTAAAGTGCTGCTGTAGGAATG
CGTCCAATGCTGCTTCATCCATGAACCTCGACACGTTGAGGAATCGAACATGGTATCGGTCTCTCGGTTTCTCATCACGTACTCCATCTGCTCCCATTTG
TCTCGCCCAGACTCCAGCTGAGTGGTGATTTAGTGATTCTACTAGCTCAACAGGGGTTGAGTGTTCATTGCGGAGTGTGAAATTCTTGTGGCGGAACGGT
AGAGTTGTAAATTCGTTGCCCCACTGTGTCGCCTGCTCTCTCGTCCAAAATATTAGGTGGACAGCATGTTGGGCACGATCATAGCAGACTTGTTTTGCGC
TTTTTAAAAGCGCCACAATACGTTCTTCAGGGTGTTTACTTCTGCGCTTTCCAAGCAGTATCATGCCTACCAGTCTTTCTCTTGATTGGAAATCTGGGTA
GACAGGAAAATCTGGGGGTAGTTGGATCACTAGGTCTCCTTCAACTTGAGCTTGAATTGCATTCTGGATCATTCGCAGTGCTGGGTTCGTGCAGACTCGC
TTGAGGAATGGTGGTAAGTGTGCACAGAGGATGGTTCCTTCCAGAAGTCCCTTGATGATTGTTGCTTCTTTTTCTAACGGCTTGCGGATTTTGGTGGGAA
ATCCGTAAGGTGTTTCACAAATTTTTCGGTATACAGGAATATCAAACGTTGAGAACTCACTACTCATGAATCGATACGGTGAGTTTTCCTCGCCCGTCAT
GTCGACGGGCTGATGTTACTGAGACCGGAAGGTGTTTCTATCATTTACGTACATGTAAGCGGACATATATTGGCATGATACTGTACATTAGAGAAATGCA
CCGGTTTTGAGTTGGCTTCAAGCAGATGCTTTTCTCGAGATGGGGAAACATAAAGTAAATGACGACCTCAGATTAAATGACGGATGCCCCTGATAGCCCA
CGATATTTTCTCTAAAAGTATGAACTTTTGGACTTAGCGCTTTTGAAGGAGAAGTCCAAGTTCCACCCTGGTCGTATCCGGTGTCGTTCCGGTTTGACAC
CAAACGAACACATTATCGCCAAGTTGCTACAAATCAAACCGTAAAAGATCTTTTATTAGTTGAAGTTTTCAAGAACTAACTACAACTACTTTTCCTAATC
TCGTTCGTGAACTACTTCGCATTGCTGGACACCAATTGCCTTGTACAAATAGCGCATACGTAGATAGGACTGCACCTCATAAAGACAGTCGGCCCACGCT
CTCGGTAAGTAGCAGTTCCAGAACAACCAGGCACCAGATGCCACACGAGCTGCTGTCTCTCTGAGTGCACCAGTCGATTTCCTTGTAGGTCACCTTGTCC
TTTAAGCCCAGCAAAGGCTCAATGACACACTGCACACTTGACTTCAAAGTTGCGAGATTCCCCTTCAGCTGGAGCGGGTCAAACGTATAACACACGTGCG
TACGCTTGTCGAGCAAATACGCCCCCCAGTGATGGTCCAGACAGATCACTGCAATGATCCGGTCGTTGGAAGGATCCATGGCTCCAAAACCAGCCGCCGT
CTTCTTCTTCACACTGAGTCCCGCGAAATCATGGTAACACGGGTTAATCACACCTACGTTCGGGTACATCTGCTTCAGTGCCAGCATCGCCGATATAATA
GACGAGCTGTGTAGCCACAAATTTTCTCGAAAATCCACCAACGAGCAACCAAGAGACCATTCAGGCCCCAGGCGAACTTGACCCAACCGCATCCCTTGTA
CTGCTTCCTTGTATGCTTGCTACATTGACAGTAAACAAATAGAAGCAGTAAGCATTGTTTAGTCCGTGATATGTGCTTTCGGTATCCATGTGTTGAAGCA
CTAACCTTTGTATAGTCGCAGGCGTCGGTAAACGGTGGGACCACGTCCTTGATCTGCCACTCAACACCGCTAATCCAATCCAGTGTGAACTGCACAAGCT
GAAATCTGTTACGCGCCTCCAGCACACTGGCCATTGCCTCTAGCTGGTCAAACGTAGCGGACCCATAATCGCTCCAGTTCGCGAGCAGGTTCAAATTATC
AGTGGCTTTAATAGCCGTGATTGCTTCTTGAATCTTGTCCAGCTGAAGAATTCGAGTGATCTTTGGTACTTGTTGGCCGACATTGTATGGCCGCACTGAT
AGACTCCCTTGGACTTCAACATCATCCAGATTTAATGTATCAACCATTGCTTTTGCGATATCCAGGCTGTAAGCGCCGTCCAGAAGAGCAGCGACATCAT
CCAGTCGAGCCTTCCGTGTTTTCTTGTCATCCCTAATCTTTACGGCCAGTGCACGCGCCTCACGAAGTTCCTTCCCCCCTGCAAGACGTCGCTTCTCACA
CTTCGAAAGTCCTCTAACACGCGGAGGGGGCGTGAATGAAATTGGTGCAGTTTTTGATCCTTCTTGGGGTGTTTCCTGTGTGAGTTCGGTGCCGTCCGGT
GTCGATCCGGTATCCCGTGATGCTGAAGTTGAAGACAGTTTTGCTTCAACATCCACGTCACCTGGTGGATCACTAGCCTCAAGACCTTCATCTTCCGGTA
CGTCATGCACTTCACCACTCGCATCTTGTACTGAAGTAGTACGTTTCTCTTCCAAGGTATCATCACCTCGTTATGCTGGTGGCGTGATCGAAGTAGCCAG
AGACGGATTGACGTAAGAAATCTGCGTGAGACCCGTCGAGCTCATGGATGATTCTTGCGATAGCACTGTCAACACATTGCTGGTTGTAGCCTCCATGACA
AACCTTGGTACGTCACCACCTTGCAGCGCGTCGTAAAATCCCTGCATCCACTCTAGCGCGACCCGAAACGTCGGGGTTGACTGCAACGCCATCCTGTCAA
CGATCTTCTCCGCAAGCTCCTTGGTCTTAATGTACTTGTCCGTTGATCCCACCACAATATCCTTGCGAATAGCTGCGCAGCTACTCTTGTAGAAGCCACC
CACTCCTACGTCACCTTCATCAATATTGTTTTGCGGTGCGTGCACTCTATTCTCTGCGTATTTGAACCACTGGTGCTTCGTGACAGGGTGGTTGTGATAC
CCAGACGCCTTCAGAGTGATGAACCAACCCGAATGTCCAGACACCACCCGAGCGTTGATCTTGGCAGTACACTCGGTTGCCCGTACCAAACGATGCTTGC
GTTTTCCAGATCCACGAGCAGCTTGAGTCCGTCCGTGAGTACACCGGAGTGTCTTGCAGTACTTGACCCAGCTCTCTGGAATGTATTGTGTGCCCTTCCG
GGTCTCTACAACTGCTGCATCTTCACCTGTCGTCTTAGCTTCACGCGCCACGGCATTACGCATTTGATTGTTGCGACTGGAGACAGAGGTGCTCGTTCGA
CTTGAAAACTGTTGGTACGTTGCCCCTTGGAACTCTTCAAACGCACGGTGGAAGTCCTCCCACGATGGCCAGCGACACGGGAAACCTTCCACAAACGCAC
ATCTTCAGCATCACTTCCGTCACGAGGCGAAAGTGTTGTCGCCGTGCGTGCTGCCTTCCGCGGAGATTTCCGGTGTCCCTTCCGGTTTCGTTTCTGTGCG
ACACCGG