Description :
From Genome Similarity Track
Location :
Scaffold_2546:618- 2756
Sequence
2138 bases(100 bases per row)
CGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTTGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGT
TGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTACTTCCTGCATGC
GATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCCCCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATA
CCTGTATACTCTGCCTCATTCACCGTGGTGGCTGAGAGGTAAGCGTTTGCAGCAATTACTATCTTTCACTCAGGAAGACTCCACAACACCCATGAACAGC
TTCCGTAGCCACCGTACTTCTCTGTCTTGGCTGATCCGTCAAAAGACATGACAAACACACTGTAATTACGGGGAAGCCTGGCGTACAGCAACGCGGGGTC
CATTCGAATAGTCGGAGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTTTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGTAGGAGCTGTGCG
AAGGCGACATCTTTCTCCTTCACGCGCTGCACCTTCAAATGCCACTGCGAAAGCAGTACGGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTGT
GCACCCACTCTAACCTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTC
CTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCGTCATGTTCTTGCATTAGCGTAGTG
CTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTT
CGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAA
GCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGACGCCCGCAAGCTTCTTGGGGTCA
GCTCTGATACCTTCTGGCGAAATTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCGAA
TCTTGCTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACC
AGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTG
CCGCGAACTTCGTTTGAAGCGAACCCTCGGCGCTTGGCCCACGACGTTCTTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACC
TCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAA
TGTCCGAGTGCGCAGACAACCGCCGATACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAATCATAGGT
AGCGCTCGCGATCTGCTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAACCGGAT
GTCCAGCCCGTTTTTTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCTCGCAACAGAGCGCGCAGCAGCT
CGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGATGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGG
CGGTGGTAGTGCGTTACCACTAGCAATCAGGATGTGCT