Description :
From Genome Similarity Track
Location :
Scaffold_2101:618- 2511
Sequence
1893 bases(100 bases per row)
GAAGCCCAGCACCGCAGCCCCACAAATGACGCGGTGTTGGGGGACTGAGAGGTCGAGTGAGCCGGCGATGATCTGGAGCATACTCGTGCTGACGGCTCCT
CGTCTGCGTTGTGGGCTGAGCCGCTGCATGCCGTTGAACGCGAGTTGGTGCTGGGGCAGGAGTTGTGGCCGGAAACCGCGGGCAAGTTGATGACACCATG
CAATGTGGCTGAGCTTAGCGCGTACGGTTTCAAATCGAAGAGGCGCTGATGAGAGGTCTGAGCGCCAGCAGCGAACCGCGAACACAGTGAGCTGTACGGA
TTGGGAGAGTGGATCGTCGACTGGTAGCCATCGGTTGAAGCCGTGCCGTGTGCAGAACTCGCACCACTGGCGCCAGGTATTGAGGTAGACTCGGCGGGAC
GTGTCGGCGAGTGACTTCCACTGGAGCGAGACAATCGTTGTTTGTAGATCTTGCGGAATTCGGCTGGGACGGCCTGTTCAGACCAGGTAGTCATATCGTT
AGTCCACTGAGTAAGCAAGCCGCCGGACCATGCACGAGAGCCTTGATCAGCCATGATATTCGCCGAGCCAGCGAGATGGGTAGTGGAGAAGTGGATTTTG
TACTGAACCTCGGCGCACGACACGACCCGGATGAGTTCTTGTCCAGTGGCGTTCTTCGAAAAGTGCCGATCGACCCACGCAACTGCTGACGCATTATCAA
TCCAGCAGCGGACATGGATCGGGTCGTGCTGCGCTAGGAATTTCCACTGCGGCCCCCAGACAACTGCTGCAAACGCCACGCTTAGTGTCTCACGGACGTT
GATGCTAAAGCCGGGCTCACCGCGAAGAATGTCGGCACGTTCCTCTTCGTCGAACTTGACCCGGATGAACTCGTGGGCTGCAGGGTAGAGTACACACAGA
CCCGTGTCGCTCGCATCCATGAATAGATACACTTGAGGTTGCGACGTACCAGCGACGATGCTTGTTGGCACCGCGTTGGTCGATCCCGCTAGAAGGAGCG
CTTCAACCCAAAGTAGGTCTTGCCGAGCGGGATGTTGGAGCCGTATCCGAGCGTGGGTTTGGGCGTTGAGCCAGGAAGAATGGAGATGCTGGAGGAAGGC
CCGAGCTGATCGAACGCACGTACTGACGTGGCGCAATGACCCCAGGAGCTGAGCGAGCTGAAGCTTCGACACGACTGATGCGCTGAGCGCCTCCCGAATC
CTGCGCAATGCCTTGTCCACTTTGTCCTTTGGCATGGAGACCGTGCGCCTCTCCGTGTCCCACAGTAGACCGAGTGCTTGCAGGCGGGTCTCCCACGCGG
AGAACTTCTTCTCGTTGATCGCGTCTGGCCCGAGTACGGCCATCATCGACAGGCGCAGTGCTTGGCCTGCTAGGGAGAGACGCCGGCCGATATCCGGTTC
CAGGAGAACGTGGTCGTCGACCCAGACGTAGGAAAAGAAGTTCGTCTCATCGGTCTCGCGCGTTGGCTCGAGAGATGCTGGGCTTTCGCGACCAAGAAGA
AACGCAATAGCACCACCAAACACACCGTAATGTGCGGGAGATCCTGTCCAGCCAAAGGGTAGAGCGAGATCGATCACCGACCCGCCTGTGAAGGCTCCCG
CAAAGAACTCAGCGAGCGCTGACGCGACTGGTATGTGGCGAAATGCCCCCTTCACGTCGCCCTTCATCATCTTGCTTCGGCAGTGGGGGTAGTGAAGTGC
GAGGAACTCGATGCGCTCCGCCAGCCGCCGCACTGGCTCAAAGGAAAGGGCTGGCAATTCGGCTTGAGACGAGCACCCATTGATTGAATTCTTGAGCATG
AACGAAAGGTTATGGATGAGCCGGCCTTCGAGGAGCGGGTCGACGTCTTTCTTTGGCACCAATCCGAACGGACTGTACCGGAGCCTTTTCCAC