Description :
From Genome Similarity Track
Location :
Scaffold_599:6179- 7622
Transcript NameFunction/comments
Phyin_T30-4PITG_21606Serine protease family S10%2C putative

Sequence
1443 bases(100 bases per row)
CGAGGGCTCTTTTGTCTGCGGTGTCACCAACAGTTCCGCGGGTCATATCAAGCTAACGAACAAGGAGGACGATCACTACTTCTACTGGTTTTTCGAGTCG
CGCACGAGTCCCGAGACGGACCCATTGGTATTGTGGCTTACCGGAGGTCCCGGCTCTTCTAGCATGTTCGCTCTATTGACCGAGAACGGCCCGTGCACCA
TCCAAGGCGACCTAAGCACCAAGTTGAACCCGTTCTCTTGGAACACCACGAACGTCATTTGGCTGGATCAACCCACAGGTGTGGGTTATTCCTTTGGCTC
TCCGGCTGACAAAGATTTTAATGAAACCAATGTGGGTGAAAACATCTATTGGTTTCTGAGGGGAATTTTGGAAAAACACCCACAATTTCAGAATCCTGGA
ACCGCAACGCTAACGTGATCTGGCTGGACCAACCAACCGACACAGGCTTCTCGTTCGGCTCTCCTGCCGACACGGATTACAACGAAACCAATGTGGGTGA
GAACATTTACTGGTTCTTACAGGAATTCTTAAACAAACACCCACAGTACCAGAACCGCGAGTTGTTCCTGACGGGTGAGAGTTATGGGGGACACTACGTT
CCCGCTGCAGCGCATTACATTTGGAAAAAGAACCAGGAGAATCCGGTCATCAATTTACAAGGTTAGCCATCGGCAACAGTCTTACGAATGCATTGATCTA
ATACGCTCACTACCAAGATATGAACGATAACCGATACAATATCACCCTTCTGACGGACGTTGAAGTAGAGCAGATGAAGGATGATAGCGTCGAGTGTATC
GAACTCACACGCGAGTGCCTGATACCACCGAAGAATGAGACTTTTTGTCTCTTGGGTGTCGATTGCTGGGATACGAAGCTGGTACAGCCTCTGAGCAAAG
CGAATCGCAACAACTACGACATTCGTGAGCCGTGCAACAACAGTGACCCTGATGCAACTGTGGAGACTTCCCTGTCATCATGGAGTTCTTAAACTCTCCG
AAAGTTCGGAAGTTTCTGAACGTGGATAAGCGCGCTCCGGCGTGGGTGGAAGAGAATGAAGTCATTCGCACGAGGTTCATTGCCGATGGAGACTGGGCTT
CATCGTACGATGCATACGCAGCGGAGCTGCTGAATGATGGTCTCCGCGTGCTCATCTACGCCGGCGACGCCGATCTGATGTGCAATTGGATCGGCAATCG
AGCCTGGACTTTAGAGCTCGACTGGCGAGGCAAGGATGGCTACTTTACTGCTGAAAAGTGAACATTCATCGCGCACGACCCCTTGATATCGAACAATAGC
CCCGCCATTGATGCAGGTGAAGTCTGGACGTTTGAGAATCTTGCGTTTGTCCGTGTGTACAACGCTGGCCACATGGTGCCAATCAACCAACCCGCCGTCT
CATTACCTCATCAGCAGGTTCCTTACCAACAAGGCATTGTAGA