Description :
From Genome Similarity Track
Location :
Scaffold_158:61784- 63251
Transcript NameFunction/comments
g14047.t1hypothetical protein
g14048.t1hypothetical protein

Sequence
1467 bases(100 bases per row)
CGTACGGCCCACTTTTTGCCAGGAAGGCGCAACACAGCTTAGGCAGACTTGTCCGCTACCCTCGTTGTGAACGAGCCATCCGTCTGTCCGAAGAAGGCCT
TTTCGGCCATGCCGCAGAAGAGACCAACCTCCACCACGCCAGGAAGCAGCTTCAGGCGATCGCAGAGCGACTTCGGGTCGCTGATCACGCCGAAGTTGAC
GTCGAGCACGAAGTTGCCGTTGTCGGTGACCACGGGGCCAGCCTTGCATTTGGCCATGCGCAGCACCGGCACACCGTTAAATTCCTTCTCCACCTTGCGC
ATGAGCGGCACGTACGCCATGGGGACGACCTCGACTGGCACCCCCTGCGTCCACTGCTCGCCCAGCAGCTTGGATTCCTTGCGGTAGTCGGCGATCACCA
CGAACTTCTTGGCTGCGAAGGCAACAATCTTCTCCTGCAGCTGGCAGGCGCCTCCGCCCTTGATGCAGTTGAGCTGCAGGTCCACTTCGTCCGCGCCGTC
AATGGTCACGTCGATCACGGGGCTCTCGTCCAGACTGGTGAGCGTGAGCTTGTGCTGGGCGATGAGCTGCTTGGCCTGGAAGGACGTGGGGATGCACGTG
ATGCCTGTGAGTTTCTGCTCCTGCACGAGTTCTCCGAGGCGCTCGGCGGCGTACACGACCGTAGAGCCGCTGCCAACGCCCACGACGAATCCGTCCTGCA
CGTACTCGTCCACGGCTTGGCGCGCAGCCTGCAGAGCAACAATTAGCCACTGTAGCGAGTTGAATGGTGGCTCTGCAGCCTGCTTACCGTGCGCTTGGAC
TGCTCGATGGCACTGAGCATGTTCTTGTCTGCCGATACTTCTCGAAATTGAGAAATGAACTGCAAGTTGGTCGACTGGCTGTGGCCCATCAACACCGGCG
GATACTGACGTACCTATGAATTACACTCATAATAAGGCACCGATTTATGCTAAAAAGCACGCAATCGATTAAAATAAAAAACGTCGGCCTCTGCCATGCT
CGGCCTCCGCTTCGTTCGCCGTCACGCCGCCGCTAACCGACTCGCTGCTGCATTCCACTCCAAGCCCCCACCCACTATAGAGAATGCGGTGCTGCTGCGT
GACCTGGAGGTGGTGCTGAAGACGGACCCGCAGGCCGCGCAGCACCTCAGCGCGCTGCTTTCGCCATCCACGACTCGGAACTTGTCTAAGGCGCTGAAGA
CGGTGCAGCAGTCGACGGGAGTGGCGGCTGTAACTTTTGAGACTTCAGCAGCAGCGGTTGCGAAGGTGACGCCCCCGACGACGCAGGAACTCAAGCTGGT
GGCGCTGCAGGTGGGGCTTCCGTTCATCGGCTTCGGCTTCGTGGACAACTTCATCATGATCCTCGCCGGAGACTACATCGACCTCACGCTGGGCGTGTCG
CTCGGTATCTCGTCCATGGCAGCGGCAGGAATCGGCAACACCATCTCGGATATCGCTGGACTGGGAC