Description :
From Genome Similarity Track
Location :
Scaffold_20:617830- 620936
Sequence
3106 bases(100 bases per row)
GCCCGCGTACTCATGGGCTGTTCTTGTGAATGTAAGTGGGACACGCGCAAGTCACTTTGGAAGATCCTTCTGGGATCCGGGCGTCTCACATGTTGATGAC
GGACCTTGACCTGTCTGGGTCAGACCGGACGCCTCCGTTGCTGACGAAGCAACCGAGAACTTAATCTCTGGTGACGCGATAACGCACTTGTCGATGTTGG
CGTAGAGCTTGTTCGCTCGCATCACGTACCAACACTCGACGGAGGTGTCCCTAGATGCACCTCCATGGTCGTCTTGCCTCCCTCGGCACGGCTATGGACG
AATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGGCCTGCG
GCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACGCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAA
ATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTG
TTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGATTCCCGCACCATGCCTGCCTTCG
CTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCAGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTC
GTGCCGTACGCCTCGATCCGGCGGGAGTTGGGTCGGTGGGTGTTTGTTCACCACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTC
TTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGG
TCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGAGGTTGGCCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTTCAGTATCTCCGCAAC
CTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCAGAGGA
GCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGGATTCGACTTGAGGCGGCGGCGGTGCCTTTGCCGACGGCGTCTGT
GACGGGGAGCTTTGTTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGATACTGTTGTACCCACACAGGAAGCGTG
TTCAACGCCTTCCGCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTAACCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGGTC
TGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAGCTAAGTTACCCGCCTGTG
GACCTAAGTTACCCACTTGGCCGACGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTGGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCC
GGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCTG
GCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGA
ACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGT
CCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATC
AGGTTTTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGTGAAGACTCTCAGGGGC
TAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTA
CCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTATAATGGCCCAT
CTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAG
CTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTGGAATCGCCTCTTCAAGGGTGCTTGCCTGCACCC
GGAACAGCTGAGTGCGTGCGAGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACACCGTGAG
CTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAAC
GCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTAAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGT
TGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTC
CTTCCCTTCATACGGCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATG
AGGCCC