Description :
From Genome Similarity Track
Location :
Scaffold_114:6178- 9546
Sequence
3368 bases(100 bases per row)
TTCTCCCGAGGAAGAGAACTCGTGCTGATGGTACGAGCGGAGACGACCGACATAAAACGTAGGATGCGTACGCATCCTGCGAGGAAACTCGATCGTGTAC
GCATTGCCTTTGCGATGTAGTACACAAAACGGGCCGGTATACTTGGGTAGTAGTTTACTACTACCCACGTTGGTTACTACGTGCTTAGGTAGGAATACTG
TAGACAGTAGAAATAAGTCTCCATCATCATTAAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCATTCTGTTTCTGCCGGTACACCGCATTAGCGAT
GGAGTTTTGCACGAAATGGACCACTGCTTCTCGTGCCAGCAGGAAATCTTCTGCTGACTCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGCACCGCTAGG
AGATCATCATCTTTTTCAGCGAGGGTGTTCTTATCCTCGTTGGTGTAGTCATTAGCGATGCTAACTATACCAGCATCGTCATCCTCATCTGGGTCAGCAA
TAGTGTCGTCACTATTGCTGAGATCACCAGCTTCGATGTCAATTTGATCGACATCGGCAACGTTCGCGTCGTCGATTAACTCGACACGTGATGAACAAGA
GTCAGAACGGTTTTTGCTCGAGCGAATCCCTCCTCCCTTGAATTAATGGCACACTCTAAATGGGTCGGTAGGCGTGGATGGCGGAAGCCGTTCACGAAAA
ATGGTGTATGCGTTGTAGATGCATGCACGGAGTTGTTGATTGCAAACTCCACCATCGACAAAATTCGCTTCAATCTGTGAAAGATTGGACGTATCCTCGA
AGTATCTCTTCGAGGATGCGGTTGACGCGTTCTGTCTGACCATCAGTCTCGGGATGGTCAGAAGTAGACATAGTCAGACGTGTTCCGAGGGATTGGAATA
CGGATTGCCAAAACGCCGCCGTGAACCAAGGATCTCTATCAGAGACGAGTTCACGGGTAAACCGTGGAGTCAGAATACCGTGTCAATGAAGACACGGGCA
CAACCATGTGCTGAGATTGACTCATTAATTGCAGCAAGATGTAACATCTTGATGAATAGGTCTACGAACACAAGAATACCATTATTCTTGTAAGCGTCTT
CGGGGAAACCGAAGACGAAGTCCATTGAAACGGAATGCCAGCACTCTGCTGGGATTGGTAGAGGCTGAAGTGGCGCACGAAATGAAGGACTGGGCTTCAC
CCGCTGGCACACTTTACAAGCACGAATGTACTTGCTTACGAACTGACACTGGCGGGGACAGTAAAAGTCGCGACTTGCCGTGAGATTAGTCTTTTCACGC
CCACGATGCCTACTAGGTGGTGCATCATGGCACTCATACAAGATGCGCAAGCGCAAATCATTATGAGTTGGTACGACGACACGAGGTGTGTCGCCGGCAA
CGGCTGTATAATACAGCAACCCGCTGCGTGTTGTGTATCGATCCGCGGATGATCGATACAAGGCCGGTAAATCTTTGAGATATTTACGAGATGGAGTCAC
CAGATGATCAATTAGTCGCAGAAGAGCCTCATCTTTTGCGTAGGCCTTTTTATGTCGTTAAGCAATGTTGACGACGGAACACTGGTGACTAGCGTTGCAA
CAGTGGTATCAACCCCACTGTTGGACTGCACAGCCGACTCGAAATCGGGTCGGCGAGTCAACGCGTCCACGACGACATTAAGTCGTCCGGGTTTGTACTC
CACGGAAAATTTTTACTCCTCAAAGAAGGACAGTCACCTCGCCATCCTTTGCGAGAGGTGTGGACTGTTTACGGCCGTGCGTAATGACGCATGGTCCGTA
TAGACTACAAACGACCTATCTCCAAGGAGATACACGCGAACTTCGCCAGTGCATAATTCATGGCAAGAAGTTCCTTGTCATGCACTGGATAATTACGCTC
AGCTGCTTCCGGCTGACGCTATTGATAGCGGACGACGCGCTCTGCGCCGTCTGCATCGTACTGCATTAACGTGCAGCCGATTGCGAAATCGCTGGCGTCA
CAGACCACATGAAATGGTCTGTATTGGTCTGCAATCGCCCATCCTGGCGATTGCATCAAGCTCTGCTTGATACCTTCAAAGGAACGTTGACAATCAGCGT
TCCATAACCATTTCTCGTTCTTTTTCAAGAGACGAGAGAGATGAACGATCATCTCAGCGTAGTTGCGCGAGTACTTGTGTAAGTACGCCGCTAGACCAAG
GAACTGTATTAGTCCCTGAACCTCGACTGGCAGAGGCCAGTCGGTAATCGCCATGATCTTTTCAGGATCAGGGCGTAAACCGTGTTTACCCACGATGCAC
CCAAGAAGTGGTATTTCGCTAGCAGCAAATATGCACTTCTTGAGGTTGGCATACAGCTTATGCTTGCGCATAAGTGTAAGAACCTGACGAACGTGTGTTC
TATGAACCTCTACATCCGTCTTTCCGCCCATAGCCCGGCTATGGACGAATACATTGTCGAAGTAACTCGGTGCGAAGTCTCGCACCGGTCTCAACAGATT
TGTTACAAATCTGTTGAATGTGGCTGGGGCATTGCTAAGCCCTTGTAGCATTACTAGCCACTCCCAGAGCATACCGCTCGGGGTGCTTACTAACGTGTAC
GGGATGTCCCGTTCACGCACTAGGATCTGATAGAAGCCATCCATCAGATCCATGGACGAAAAGATGGTACTCTGTGACATACCATCAATGATTACGTCCT
TCCTCGGTATCGGCGTCTGAGACGGTACCGTTGCAGCATTCAACTTGTTGAATACGTGCACTATCCGCCATCCTCCTGTGGCCTTGCGCACACAGAAGGT
CGGAGAGGTATGAGGGAAGTTGACTCTCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCGATCGCAAGTACTTGTTCACGAGGCAGTGGTC
ACTGCTTCATGACACAGTACTGCGAGCCCGTTTTGAGATCGATTTCATGTCGAGTGCCTTTATCCTTAGACAATTCGCATGGTACGGATTCAGGGAACAC
GTCCTTGAGTTCGATCAAAAATCCTTATATAAAGGATTTGCCTGAAGCGACTCCCAAGATTGAGACGTGTATCGCTCAATCCGAGTCTTCTCATCGAGGA
AACTTTCGTCCATTCATGAGCTGCTGAGAACCCGTTCGTTCTCGGCAAAGATTACTGCCAACCGAATGTCAGTCACGTACTCGTCCTCCATGACGAGTAC
ACAGATCTGCTTGACCTTGCCACTACACAGATCTCGCTGGAACCGTTTCGGTTCTAGCGTTGGCAATTGAGTGATCTCCGAAGTCAACTTCGGAGGCGCA
ACCAGATCAAGTGTATAATCGCCTACACTTGACCCGTCATTAACCAAGACATTCAATGTTTTGGCTTC