Description :
From Genome Similarity Track
Location :
Scaffold_142:6176- 8846
Transcript NameFunction/comments
g1907.t1hypothetical protein

Sequence
2670 bases(100 bases per row)
CCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCGATCTCCGCTTTCGTCCTGCTGAAGATCATGAGGTCGTCCACGTAGACGA
TAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCGCCGCTGACCGATGGAAACCTTGGCCCTCCAGGTGCTTGTTCAGCTTGCT
GTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAGGCACTTCTTGGTTGGGTTGACTTGGTCTTCAAATCCGTCCGGCTGGTCC
ATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGTGTCCACATCCACATTTTCAGCCTCCATGTCTTCCTCTGCTGCAATCGCCACCGCCGTGT
TGATGGACTCTTTGCGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGACCCCTGGACGTTGCGTGAAGCCCTTCGCCACAAGACGAGCCTTGAACTTGAT
GATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCGATCGCCTTCTTGTCTGACGGCATGTCCACCAACTTCCAGGTGCGGTGATCC
TCAAGCGACTTCATTTCGCGTTCCATGGCGCGCAGCCATTCGTCCTTGTACTTGCTCCGCATGACTTCATCGTACGACACCGCGCGCTCACCGTCGTCGT
CTTCGGTGAGGAAGCAGTAGAGGGAATCGAACTCAGCCTCGTAGTCGTCCAGGTTGAATTCACCCCTTCGAGTCCCGGGAAATTCGTCTTGGTAGCGCAC
GACTCCACGCCTTTTGCGTGCCGGACGCACCATCCACTCCTCTTCGCCGTCTCTCCCTGGCGTGCTAGAGCCACGCGTTGGCACAGATCCGGTCGGTCCG
CTGTGCTCCTCGGGTTCGTGGAGTGGGCGTGTTGGGGGCGTGCTGAAACCGTCGTCAACACTGGGTTCTTCGGTGCGCTCCTCTTCTTCATCGTTGTCGA
TGATGTCGATCACCTCCTGGTTGCGCGTCTTCACCATTGTGACCGGTGGCGCTTCAGCAAACGTCACACTCCTTGAAATCACGATCGATCCGTCGCTGGG
GTCCAGGAGTCGATATGCTTTGTGTTGCTTGGCGTAGCCGAGAAACACGCACTTGATCCCCGAGTTGTCCAGCTTTTTGCGTTTCTGCTTGGTCACATGG
GCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGCTGGAATGGGCTTGCGTGTGGGCTTGACGTGTTAGGCA
ACACGTTCCGAATGTCTGCAGCTGTCATGATGGCTTCGCACCAGTACGACTTGTCCATCCCGCTCTCCTCCAGCATGCAGCGTGTCATTTCGACCAGCGT
ACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCACCATCCCCGCG
TTGCAGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAACGCCTCACACACTT
CGCTCTTCTTGCGCAGTGGGTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGCCCGACTTGGATGCAGGAGTGACGGG
CCCCAACACATCAGAGCACACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTTGAAAGGCTTGCGTGCCTGCTTCGCA
GTCGCACACACGCCACACACGGTTCCAGGCTCTGCCAGCGCACCCTTGAGTTTCCCGTCCTTGATCATGGAGTTTAGCGTGCCGAAAGACGCGTGGCCGA
GTCGCCGGTGCCACAAATCCATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCAGCTTGCCTTGCTTCCTGCCCGTCGC
CACCACTTGGCCGCCGCGTTTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCATTGCAGCCGTGAGAGAGAACAGGTTCTTGTTC
AAATCTTGAACGTGCAGTGTGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACTGTTCCAACCCCGAGAATCTTCAAGC
TCGCGCTGTTCTTTGCGCTCGATATGGTGCGCGCAGTCTTTACACCCGAGTACTCTTGAAACGCGTCGCGTGTCTTGCACATGTGTGCCGAAGCACCGCT
GTCCATCACCCAGCACTCGCTAGCAAAAGCTTCCGTCGCATGGAACGCAACGTTCGACTGGTCTTGGACATTTTCATCGGGACTTGCCTCGGAACGGCAA
TCCCTCGCATAGTGCCCAGGCTTGCCACAGTTGAAACACTTCCCGAAGGGCCCCTTCTTGCGCATCCCGCGTGCGTTCTTCTTCTTCTGCTGCTGCTTCC
CATTGCCCTTGCTGGCAAGAAGCGCAGTCGCCTCTTCGATGCGGTTCGAGTCCTTCTGACGCACTTCTTCCGCAATCAGCTTGCTCACCAGGTCTGCAAG
CTTGAACTCACTCACTGACATGCGAAACGCTTGAACCAGAGCCTCGTAGCTCGATGGCAGACTCCGCAGC