Description :
From Genome Similarity Track
Location :
Scaffold_17:61756- 63951
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_17-snap-gene-0.29Myosin

Sequence
2195 bases(100 bases per row)
GAGGACCGCGTTGTGGACCTGAATGATAAGAATACCAAGGCTCTCTTCGCGCGTCTGCAGCTCGACAACGCCCTCCcTTACCAGAACGAGAATGTGGGGg
AAACGGgCATTGAAGACATGATCTCACTCAACTATCTGCACGAACCCGCGATCCTTTACAACGTCAAGAAGCGCTTTCTACAGAAACTCCCCTACACATA
TACTGGCGACATCTGCATCGCCGTGAACCCGTACCAGTGGCTGCCTGAGCTCTACTCTGATGAACTGCACGCACAGTACCTAAGCAAGCCGAAGGATGAA
CTCCCGCCTCATGTGTACGCGACCTCAGTGGCGTCTTATAACGACATGAAGCGCTTTGATCGCAACCAGTCCATTCTGGTGAGCGGTGAGTCGGGTGCTG
GCAAGACGGAAACGACCAAGATCCTCATGAATCACCTCGCATCCGTGGCCGGTGGTCTGAACGACTCGACTATTAAGAAGATTATCGAAGTCAACCCGCT
GCTCGAGTCATTTGGTAATGCCAAGACTGTGCGCAATGACAACAGTTCACGATTCGGTAAGTTCACACAGCTGCAGTTTGATCGCACAGGCACACTGGTC
GGTGCTAAATGCCGAACATATCTGCTTGAGAAGACGCGTGTGATATCGCAAGAAGCACCCGAGCGCAACTACCACATCTTCTACCAGATTCTCGAGTCGA
GTGATGAGAACCCCGACTGGATGTTGCAGCGTACGAAGGCGTATTCGTACACGGGTGATAGTCGACAGACCCAGATTGAAGGCGTCTCGGACGCCAAACA
CTTTGAAAAGACGCGGACAGCCCTCGGTTTGATTGGGTTGGgCATTGACGAACAGCAAGTTCTCTTTCAAGTCCTTGCTGGTATTCTTCACCTCGGGGAA
gTGAAGGTGCAAGCGAAACCTcAGAATGATGAAGAGTCGATGCTcGTGCCAGGAGACCTGGGGACTGAAGCTGCGACGAAGCTACTTGGTGTTtCCACTG
CCcAGCTCGAGACAGCTCTGTGTACACGAAAAaTCTCTGTCATGAACGAAATCGTGACAGCTTTCATGAAGAAAGATCAGGCTGATGAATGCAGAGATGC
TCTGGCAAAAGCGATTTACTCTAAAATCTTCGATTGGTTGGTCGCTCGAATCAATGAATCGCTTGCTAATGATGGTCATATGAAGCACCAAGTGGGCATT
CTGGATATTTTTGGTTTTGAACACTTCAAGCACAACTCCTTTGAACAGTTCTGCATCAACTACGCAAATGAGAAACTGCAGCAAAAGTTCACGCAAGATG
TGTTCAAGACAGTGCAAATCGAGTATGAAGCAGAGGGAATCGCCTGGAGCCACATTGATTTCGCCGACAACCAGGATGTTATCGCGATCATTGAAGATCG
CCTCGGTATCATTTCTCTGCTGAACGACGAGGTCATGCGACCAAAGGGAAgCGATGAGTCTCTTGTTTCGAAGTTGTCGACGATTCACAAGGATGATAAg
CATGTCATCGAGTTTCCACGAACGTCGCGCACTCAATTCACTATCCGACACTACGCGGgCGCTGTTACATATGAATCTATTGGCTTCCTCGAAAAACACA
AGGATGCTCTACTTCCAGATCTCTCGGATTTGATGCGCTCGTCATCAAAGTTCTTTTTGTCTGGTCTCTTCAAGAGCGAGGATGCTGTTTCCGCTGCTGC
AGTTGCTCCCAAGCCACGAGGGGGTCGTGCAGCTGGTGGTGCGTTGACCGTAGCAAACGTCGGAACGCAGTTTAAGGACAACCTCAATGAGCTCATGGTC
AATATTCGTGAGACGAAGGTTCACTACGTGCGTTGTGTCAAGCCAAACTCTCGTAAGAGCTCATCAATGATGGAGCATTCGATGGTGGTTTCACAGCTTC
GATGTGCTGGTGTGATTGAAGCAATTCGCATTTCGCGAGTTGCTTATCCAAACCGTCTCAATCTGGAAGAGCTGCTGAATAAGTTCTGGATTTTCGCCCC
cAAACCcACAACTGAGATGAGTCTTCGCGATCGATGCCAGCAACTTGTTGATACTATGGGATTCAAAACTCCAGAGGAGTATCAAGTCGGTCGGACAAGA
ATGTATTTCCGATTTGGTATCCTCGAAGCGATGGAGGAGAAGAAGAGCAAACGGCTTGAGTCGCAGGCTCGCAAGCTCCAACACATCATGAAGGG