Description :
From Genome Similarity Track
Location :
contig_93:61749- 63448
Transcript NameFunction/comments
g13209.t1KUF96767.1 cGMP-dependent protein kinase [Phytophthora nicotianae

Sequence
1699 bases(100 bases per row)
AGCAGTAAGCATTAGCGGAGCCCGTGGTGACTTACCGAACTTCCTGCGCCGCCCTTTCATGATCACGTGGCAACGTGTAGCCGGTCCAACATGTAGTCAT
TCTCCGAATGGCGTTGCTGCGGCTGCATGGCTCAAGCCGCATCAAGCGCATATGAAGCATGCAATGAGCCAATGGACTTCCTGTGAGAAGAGAAGTGCTG
GTCGCCTCAATCTTTAGTTAGCGCGACTATTTTTGCTTTTAGCCGAGGCGTCTGAGCCTGGCCTGGTGGCGGAGGAAAAAATAGCCTCTTTGGTCGGCGC
TGGCGTGGACGACCAAGCCCTGCACGCATTTCTACTGGCGAAGGCAGCAATTCTTGTCACAGCTGGCTCAGCGTTGCCGCCCGTGCATGCAAGTCGGCGC
GGGTCGGACGTCTACCTGCAGCTAACACTCTCGACTCCTACCTGTCAGGGGATGCCCCACGCCTAACGAACTTCTTTTCGACTGCCAGTTGCGACCTTTT
CGATGGGCGGCGGCGTGTCCAAGCACGAGTATGAACGCATTCGCAAGGAGCTGATGCTCAAGGACCAAGTCATTCGCGCCTTGCAGGAACGACTGGCCAA
TGGCGGCTACATTGGTCCGATGCACGCATCGCCTGGTGGCGACTCGGATGAGAAGGTAACGCCTGAAAGAGCTGCAGCGGCAACGATGGTGGCAAAGGTG
AGGGGCAAGGAGAAAGACAAAGAGTCCCGCGTGTCGAACGCCGAACATACGCTTCAAAAGGGAGGCAGCTTCAGCTCGCGGTTCACGTTACTTGACGAGG
CAAAGGAGTTGCTACGAGATAGCATCGATCACTCTGACAGCGACGCAAAAAGTCGATACAACTCGACGGATGAAAATGGCGGACCCGATAGCAGCGGGCA
TACCGCTGGGTCAAAAGGCAAATTGCGCCGTGTCGAGGTTAGTGCTGAAGTCATGCCAAGTCGGAAGATCATGTCGACAAAGGAGCGCGTAGTATACCCG
AAAGGAGATAGCTCCAGAGAGCTTCTGCTCAAAGTGCTACAATCGAACGTGCTGTTCAAAGGCCAGTCGTACGGCGAGCTTCGAGATTGCTTGGACGCCT
TCTTCCCGATGCGCGTTGAACCCGGTCACTTCGTGATCAAGCAAGGAGCGCAAGGAGACAACTTTTACGCAGTGGAAAGTGGGCAGCTCGAAATTCTAGT
GTCAATGGGCGAAGCACCACCGATCCGCTACGGCTACCTGGGTCCTGGCTTGGGTTTTGGCGAACTGGCATTGCTGTACAACATGCCACGCGCTGCCACA
ATCCGTGCAGTGACTGAAGTCGAGCTCTGGGCTCTGGAGCGTAACACTTTCAGGGAGATCCTAGCTTCGCACAAGCTTAATCGTCTTCACCGGACACTTG
AGGTTTTGGAGAAGGTTGCGATACTCAGCAAACTTACCTCATCCGAAAAGCAGCAGGTTGCAGCAGCAATGGACTGGGAGGAGTTTGAAGGGAAAGCTGC
AATTGTGCGGCAGGGAGAGGTTGGTGAGAAGTTTTACATCATCACCAAGGGCGAGATTGTCGTCACTCAACTGGACGCCAACACGAGCGAGGAAAACATT
ATCCGAAGACTGAAGGCTGGCGATCATTTTGGTGAGATGGCTCTTTTTAAGGATGAGATGAGGTCTGCAACCTGCACGGCAGTCACAAGAGTGCAGTGT