Description :
From Genome Similarity Track
Location :
Scaffold_12:617305- 622526
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005352Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
5221 bases(100 bases per row)
GCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGTAGTCCTTCCAACGACCAAGTCAAGAGTCTGCATAG
GCCGCTTGTGTAGCGTGCGCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGGATTGAGACGCCGATGGGCTCGATGCCTGGAGAAAC
CGTGGAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGGTCATCGGTGAGGCGGCTGTGATCAGC
TTGCTGAAATCAGCGTCACCGGTTGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGATCATGAACTCTCATCGACAGTCTGCAACTCCTGTCA
CGACGATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGTACCGTGGCGGAGAGAACGAGCCTCTAGCGAGATGGTTCGTTGAGTTGGATGCAGCGAT
CGCTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAAGTTGGGCGTATGGGAAGCGATTGGCGG
AGCCACATTGCTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGAATTTCGGGCTCGCGCAGAGTTTTTAAA
GCTTCGTCAGGGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCATCGTGGACGAGCCGATTGACATCCCAACGCAAGTC
GTGACGTTCATGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAAGACCCTGGAGGAGCCATCAGCCGTGCGATGCAAGA
AGAATTCAGCATCAAGCAAGCCAAATTCCAAGGTTTTCCGGCAAGACCACCAAGGCAACCAAACGTTGTTCATGATGGCCCAGAGCCGATGGACATCTCG
TACATTTCCACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGCCGGGTCACTTCGCTCGGAACTGCAAAGTGTCTTTGT
CTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTTCGATCGTTCCCAAAGGTCAAAAAACGGGAACGACCA
GTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGAATGTTGTGGAAACACAGGACTCTGGCCCCAATGTGCATGATGCACATGCAGTTTCCA
CGAGTGAGAAGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTCTACGAGCTTTGGTTGACACTGGTGC
GTCGAACAACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAATGAAGAGAAGACGATGATTGTTCGGTTGGCCAACGGG
TCAACTGTGAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCGAGGACGAGTTCATCCTTCTCGACCTCGATGACAAGT
TTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACATGAAGATCTCCGTTGACAAGTCATGCAGCGCTGACTT
GAGCAGCATGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGCCCTTGTGATATTGCGGTGTGCGATGGCCCCCCATGT
TCACAAGTGGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGACTGTCTCCTTTGCCATCGACGACAAAGTTGCGTGCG
ATGGTAGTATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGACCAGCAAGAAGAGTGTTTCATCAAGAGTTTCAAGTGC
CCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAATTTGTGAATATCGCGGTCTGCAAGGAAGAAGGTGAC
GTGAATGTAATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCTTGCCATCGATGAGCAAGAAGACGCTGAAGCGTAGCC
TAGCGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGGCGATGCAGAGGACATCAGCACAGTATCAGCAATGGAAGCTGAAGTGCTTGATGA
GAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTATGCACTTGCCAGGGAATTTGAAGACATTTTCCCAGAC
AAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGAAGTACTGCATCACAAGACAGTGGCCGTTGCCAA
AGGAACAAGTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGAGAGTAAGTCTCCGCATTGCAGCCCCACTTTCTGTGT
GAAGAAAGCAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATACCTGCTCAAACTCCGGTTCCACGCAAGGACATGATC
CTTGATGGAATGGTTGGCAGCACCATCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCGAAGATGATGTCCCACTAACTGCAG
TGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCGCAGGGACTGAAGAATGCACCCGCGACCTTCAATCGAATGGTCACGAACGTTCTTCG
TCCTTTACGAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAATGGGAGATCTGATGTTGATGTTCATCTTGATCATCTT
CGTCAAGTTTTCCAGGTCATGCGTGAAAACAAACTGTACGCAAACTTGAAGAAGTGTATGTTCTTCGCTCCCGAGATCCCTGTTCTCGGTTGTTTTGTGG
GCAAGAACGGTGTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGAGCCAAAGAACGTCAAACAGCTGAGACAATGGTTGGGTCTGGC
CAATTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCCCTCACACAGCTCTTGAAGAAAGACGTTGAGTGGAAGTGGTCGAAAGACCAT
CAAACGGCGTTCGAAGAAGTCAAGAGGAGTCTTCGTGAAGCTCCTGTGTTGGCTTTACCGGACCACGACAAGCCGTTCCATGTCGTCTGTGATGCGAGCG
ACTATGCCATCGGTTGTGCATTGATGCAACACGATGATGAGGGTCGAGAGCGAGTTGTTTCGTATCAGTCACGACAACTCCGACCCGCAGAACGGAACTA
CCCAGTTCATGACAAGGAACTTCTGGCGATGAAGTATGCTCTTGTCAAGTTCCGTGTCTATCTGCTTGGCGAGGAGCGCTTTGCTATTTACACTGATCAC
GCATCACTGCGGACAGCGGTAAAGACTCCTCACTTGTCGCAAAGAATGGCGAGATGGCTTTCCTTCTTTGCAGAGTACAACTTTGTTGTACACTACAAGC
CAGGCAAGACGAACATCTTAGCCGACGCATTGTCAAGACGTCCGGATTACGATCCGAAGTCCAAGAGTGACAATCTGGACGAAGAATGTCGACTTTGCGA
AGATGTTCAAGCGATCGCAGTTCAAGCCACGACGACAGTGCGAGAAGAGATTGTCGAAGGGTACAAGTCTGACGACACATGTCAGGACTTGTTGAAGTAC
TTCAAAGATCCTTCGGACAAAGCACTGCAGAGCTTGCCTGCTCGAACAAGATCGCGTGTTCACCGCTTCCAAGTACACAATGGGTTGTTGTACTATGCGG
TTGAAGATGGGGATACAGCAAGGGTTGTTGTTCCCAACGACGAGGGCCTGCGTCATCGACTCTTGTATGAGTATCATGACAGTCCCTCAGGTGGTCATCT
CGGACGTGAGAAAACGTTTCTCAATCTTTCCCGGGATTATTACTGGCCACACATGTACAAGTGGGTTCGCAAGTATGTGAGGACTTGCGAAATCTGCCAG
CGTGTGAAGCCCTCTGGCTCCACACAAGCCCCACTTCGTTCATTGGCAGTGCCAACTGACAGCTGGAAGTCCGTGAGTATGGATTTCATATTCGGACTTC
CAAGGGACAAACACGGCAGGAATGGCATCCTGGTGTTTGTGGACCGATTTAGTAAGATGGTGCATCTTACTCCGGTCTCTGACAAGATCTCGGCAGAGAT
GACTGCGAAAGTCTTTGTAGACGTGGTGTTCCGTCTACATGGTCTGCCTTGGGAGATCGTGTCCGACCGAGACACTCGGTTTACGTCCAGATTCTGGCGT
ACTCTGTTTGGCATTTTGGATACGAAACTATCCATGTCAACAGCAGCACACCCAGAGACAGACGGTCAAACTGAACGAGTGAATCGTGTCCTGGAAGACG
TGTTGCGCAGCTATGCGACGTCTTTCGGAGAGTGGAGTGAGTTTCTCCCTCTCGCTGAGTTTGCGTTGAACAACTCCACGCATGTCTCGACAGGTCATAC
CCCGTTCTATGTGAACTACGGACTCCACCCGAGAGTGCCAGCGTCACTAGTGGGAGAGGTTTCTACCTTAAGTGGGGGGAGAGACTGCGGCTAAGAGCCA
CAGTCGGACCTGAATGCTGTTGCCGAGTTAAAAGCGAATTTTGACTCGATGAAACCTCTAAACGACATGACAAGTCGTGAGGCACAGCAAGTCGATGACT
TTATTGTGAGGAGACAGCCATTGTAACGTTTGTTCGAGACGCAATTGCAAAGCTCAGATCTGCAAAAGAACAGCAGACAAGAGTGGAAGGAAGAACAAGC
AAGTATATAAGATTAATGATCTTGTATTACTTAGTACGGCTAATCTGCCTGAACATGCAGTGTCTAACTTGGGGAGTTCGAAACTTCTGCCAAGATATAT
TGGGCCATTCAGGGTAGTTAAATGCAATGGGGATGCATACACACTAGACATTCCTAAACGCATGCGACTACACCCTACGTTCTACGTAGGACGATTAAAG
CTTTACCTTCCAAGTGGGTCA